ID: 1178492317

View in Genome Browser
Species Human (GRCh38)
Location 21:33060584-33060606
Sequence TGGATCCCCAGTGCTTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178492317_1178492324 18 Left 1178492317 21:33060584-33060606 CCTGTCCAAGCACTGGGGATCCA No data
Right 1178492324 21:33060625-33060647 ATGGAAGCCTCTAGAGCAGGAGG No data
1178492317_1178492322 -1 Left 1178492317 21:33060584-33060606 CCTGTCCAAGCACTGGGGATCCA No data
Right 1178492322 21:33060606-33060628 AGCTGAGAGCAGGGCTTTCATGG No data
1178492317_1178492323 15 Left 1178492317 21:33060584-33060606 CCTGTCCAAGCACTGGGGATCCA No data
Right 1178492323 21:33060622-33060644 TTCATGGAAGCCTCTAGAGCAGG No data
1178492317_1178492320 -10 Left 1178492317 21:33060584-33060606 CCTGTCCAAGCACTGGGGATCCA No data
Right 1178492320 21:33060597-33060619 TGGGGATCCAGCTGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178492317 Original CRISPR TGGATCCCCAGTGCTTGGAC AGG (reversed) Intergenic