ID: 1178494241

View in Genome Browser
Species Human (GRCh38)
Location 21:33073230-33073252
Sequence CTTAAGGAGAAGTCAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178494234_1178494241 3 Left 1178494234 21:33073204-33073226 CCCGGCTACCATGCTGTGTCTAT No data
Right 1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG No data
1178494236_1178494241 -5 Left 1178494236 21:33073212-33073234 CCATGCTGTGTCTATTTCCTTAA No data
Right 1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG No data
1178494235_1178494241 2 Left 1178494235 21:33073205-33073227 CCGGCTACCATGCTGTGTCTATT No data
Right 1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178494241 Original CRISPR CTTAAGGAGAAGTCAGGACA GGG Intergenic
No off target data available for this crispr