ID: 1178494633

View in Genome Browser
Species Human (GRCh38)
Location 21:33076359-33076381
Sequence CTCCAGGTACAGGGCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178494633_1178494643 8 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494643 21:33076390-33076412 CAAGGCAAGCCATGGGGCCCAGG No data
1178494633_1178494636 -10 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494636 21:33076372-33076394 GTACCTGGAGCACCAGTCCAAGG No data
1178494633_1178494644 15 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494644 21:33076397-33076419 AGCCATGGGGCCCAGGAAACAGG No data
1178494633_1178494639 1 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494639 21:33076383-33076405 ACCAGTCCAAGGCAAGCCATGGG No data
1178494633_1178494648 28 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494648 21:33076410-33076432 AGGAAACAGGCTCCCAGCACTGG No data
1178494633_1178494641 2 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494641 21:33076384-33076406 CCAGTCCAAGGCAAGCCATGGGG No data
1178494633_1178494638 0 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494638 21:33076382-33076404 CACCAGTCCAAGGCAAGCCATGG No data
1178494633_1178494649 29 Left 1178494633 21:33076359-33076381 CCTGACAGGCCCTGTACCTGGAG No data
Right 1178494649 21:33076411-33076433 GGAAACAGGCTCCCAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178494633 Original CRISPR CTCCAGGTACAGGGCCTGTC AGG (reversed) Intergenic
No off target data available for this crispr