ID: 1178496968

View in Genome Browser
Species Human (GRCh38)
Location 21:33094954-33094976
Sequence GAGTCCCACCAGCAGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178496966_1178496968 -6 Left 1178496966 21:33094937-33094959 CCACGTGGATTTTCCAAGAGTCC No data
Right 1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178496968 Original CRISPR GAGTCCCACCAGCAGCTGTG AGG Intergenic
No off target data available for this crispr