ID: 1178498933

View in Genome Browser
Species Human (GRCh38)
Location 21:33109989-33110011
Sequence CCTAACAAGCCCAAGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178498933_1178498942 18 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498942 21:33110030-33110052 TCGAGGGTTAGGCAGCTCCAGGG No data
1178498933_1178498940 7 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498940 21:33110019-33110041 CCAGTCGCTAATCGAGGGTTAGG No data
1178498933_1178498935 1 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498935 21:33110013-33110035 AACCTCCCAGTCGCTAATCGAGG No data
1178498933_1178498943 21 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498943 21:33110033-33110055 AGGGTTAGGCAGCTCCAGGGCGG No data
1178498933_1178498941 17 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498941 21:33110029-33110051 ATCGAGGGTTAGGCAGCTCCAGG No data
1178498933_1178498945 25 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498945 21:33110037-33110059 TTAGGCAGCTCCAGGGCGGGTGG No data
1178498933_1178498936 2 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498936 21:33110014-33110036 ACCTCCCAGTCGCTAATCGAGGG No data
1178498933_1178498946 26 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498946 21:33110038-33110060 TAGGCAGCTCCAGGGCGGGTGGG No data
1178498933_1178498944 22 Left 1178498933 21:33109989-33110011 CCATCAAGCTTGGGCTTGTTAGG No data
Right 1178498944 21:33110034-33110056 GGGTTAGGCAGCTCCAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178498933 Original CRISPR CCTAACAAGCCCAAGCTTGA TGG (reversed) Intergenic
No off target data available for this crispr