ID: 1178500387

View in Genome Browser
Species Human (GRCh38)
Location 21:33121343-33121365
Sequence CCAGCCAGTAAGTGTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500387_1178500391 3 Left 1178500387 21:33121343-33121365 CCAGCTCTACACTTACTGGCTGG No data
Right 1178500391 21:33121369-33121391 ACTTTGCCACTTAGTATCTCTGG No data
1178500387_1178500392 4 Left 1178500387 21:33121343-33121365 CCAGCTCTACACTTACTGGCTGG No data
Right 1178500392 21:33121370-33121392 CTTTGCCACTTAGTATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500387 Original CRISPR CCAGCCAGTAAGTGTAGAGC TGG (reversed) Intergenic
No off target data available for this crispr