ID: 1178500516

View in Genome Browser
Species Human (GRCh38)
Location 21:33122147-33122169
Sequence CTTCTTGTGGGGATTGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500516_1178500524 12 Left 1178500516 21:33122147-33122169 CCAATTCCAATCCCCACAAGAAG No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500516 Original CRISPR CTTCTTGTGGGGATTGGAAT TGG (reversed) Intergenic
No off target data available for this crispr