ID: 1178500522

View in Genome Browser
Species Human (GRCh38)
Location 21:33122160-33122182
Sequence GACCCTCTAAATTCTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500522_1178500524 -1 Left 1178500522 21:33122160-33122182 CCACAAGAAGAATTTAGAGGGTC No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
1178500522_1178500526 25 Left 1178500522 21:33122160-33122182 CCACAAGAAGAATTTAGAGGGTC No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data
1178500522_1178500528 28 Left 1178500522 21:33122160-33122182 CCACAAGAAGAATTTAGAGGGTC No data
Right 1178500528 21:33122211-33122233 AGTCAAAAATTATCAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500522 Original CRISPR GACCCTCTAAATTCTTCTTG TGG (reversed) Intergenic
No off target data available for this crispr