ID: 1178500524

View in Genome Browser
Species Human (GRCh38)
Location 21:33122182-33122204
Sequence CCCACTCATCTTTTCAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500517_1178500524 6 Left 1178500517 21:33122153-33122175 CCAATCCCCACAAGAAGAATTTA No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
1178500516_1178500524 12 Left 1178500516 21:33122147-33122169 CCAATTCCAATCCCCACAAGAAG No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
1178500519_1178500524 1 Left 1178500519 21:33122158-33122180 CCCCACAAGAAGAATTTAGAGGG No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
1178500521_1178500524 0 Left 1178500521 21:33122159-33122181 CCCACAAGAAGAATTTAGAGGGT No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
1178500522_1178500524 -1 Left 1178500522 21:33122160-33122182 CCACAAGAAGAATTTAGAGGGTC No data
Right 1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500524 Original CRISPR CCCACTCATCTTTTCAAGTT AGG Intergenic
No off target data available for this crispr