ID: 1178500526

View in Genome Browser
Species Human (GRCh38)
Location 21:33122208-33122230
Sequence ACCAGTCAAAAATTATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500521_1178500526 26 Left 1178500521 21:33122159-33122181 CCCACAAGAAGAATTTAGAGGGT No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data
1178500523_1178500526 3 Left 1178500523 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data
1178500522_1178500526 25 Left 1178500522 21:33122160-33122182 CCACAAGAAGAATTTAGAGGGTC No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data
1178500519_1178500526 27 Left 1178500519 21:33122158-33122180 CCCCACAAGAAGAATTTAGAGGG No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data
1178500525_1178500526 2 Left 1178500525 21:33122183-33122205 CCACTCATCTTTTCAAGTTAGGA No data
Right 1178500526 21:33122208-33122230 ACCAGTCAAAAATTATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500526 Original CRISPR ACCAGTCAAAAATTATCAGC AGG Intergenic
No off target data available for this crispr