ID: 1178500721

View in Genome Browser
Species Human (GRCh38)
Location 21:33123691-33123713
Sequence TTTGTCAGTGGCTGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 862
Summary {0: 1, 1: 0, 2: 6, 3: 93, 4: 762}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178500721_1178500731 30 Left 1178500721 21:33123691-33123713 CCCTCCACCCAGCCACTGACAAA 0: 1
1: 0
2: 6
3: 93
4: 762
Right 1178500731 21:33123744-33123766 AAAGTTCTTATATGCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178500721 Original CRISPR TTTGTCAGTGGCTGGGTGGA GGG (reversed) Intergenic
900573497 1:3371555-3371577 TGGGTGAGTGGGTGGGTGGATGG - Intronic
900650086 1:3726273-3726295 TGTGTGGGTGGGTGGGTGGATGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901272735 1:7965624-7965646 TTAGTAAGTGGGTGGCTGGATGG + Intronic
901780163 1:11588897-11588919 TTTGTCTGTGGGGGGGTGGGGGG - Intergenic
901839919 1:11947759-11947781 TCGGTCAGTTACTGGGTGGAGGG + Intronic
901928721 1:12583468-12583490 TAGGTGAGTGGATGGGTGGATGG - Intronic
902040976 1:13492122-13492144 TTTGCCTGTGCCTGGGAGGAGGG - Intronic
902169101 1:14596611-14596633 TTTGTCAGGGGCTGTGGGGAGGG - Intergenic
902261878 1:15231810-15231832 TTTCTCAGGGCCTGGGAGGAAGG + Intergenic
903473367 1:23602900-23602922 TTTGTCAGTGTCTTGCTGCATGG - Intronic
903617666 1:24673569-24673591 TCTGTCAGGGGCGGGGTGGGGGG + Intergenic
903634751 1:24804383-24804405 TGTGTGGGTGGGTGGGTGGAGGG + Intronic
904036507 1:27561923-27561945 CTTGTCAGAGGCTGAGGGGAGGG + Intronic
904116806 1:28168588-28168610 GTTGCCAGGGGCTGGGAGGAGGG + Intronic
904899033 1:33841799-33841821 TTTGATAGTGGCTGAGTGGGTGG - Intronic
906008248 1:42498262-42498284 ATTGCCAGTGGCTGGGGAGAGGG + Intronic
906008710 1:42502701-42502723 GTTGCCAGAGGCTGGGGGGAGGG - Intronic
907232881 1:53016709-53016731 TTTGTGTGTGCCTGGGTAGAGGG + Intronic
907254752 1:53170447-53170469 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
907336123 1:53700783-53700805 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
907869916 1:58433636-58433658 CTTGTCTGTGTCTGTGTGGAGGG + Intronic
908529028 1:65016173-65016195 TTTGTCAGGGGCTGGGGAGAAGG + Intergenic
909099610 1:71333887-71333909 TTTATCTGTTGCTGGTTGGATGG + Intergenic
909288151 1:73847457-73847479 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
910660716 1:89669261-89669283 GTTGCCAGGGGCTGGGGGGAGGG + Intronic
911824069 1:102458816-102458838 GTTGTCAGTGGCTGTGGGTAGGG - Intergenic
911833536 1:102585302-102585324 GTTGTCAGGGGCTGGAGGGAGGG + Intergenic
912482906 1:109998057-109998079 TATGTGAGTAGCTGGTTGGAAGG - Intronic
914434881 1:147651016-147651038 TTTGTCAGTGGCTGGGTTCTGGG - Intronic
915991303 1:160519775-160519797 TTTGCCAGGGGCTGGGGGGGAGG + Intronic
916074649 1:161193443-161193465 GTTCTCAGGGGTTGGGTGGAGGG - Intronic
916705735 1:167347694-167347716 GTTGTCAGGGGCTGGGGAGAGGG - Intronic
917457617 1:175198961-175198983 TTTTTCAGTGGATGGATGGATGG - Intergenic
917856896 1:179108483-179108505 GTTGTGAGTGGTTGGGAGGACGG + Exonic
918190298 1:182167483-182167505 CTTGCCAGGGGCTGGGAGGAAGG + Intergenic
918224586 1:182469986-182470008 GTTGTCAGGAGCTGGGAGGAGGG + Intronic
918472167 1:184885638-184885660 TTTGGCAGTGACAGGGAGGAGGG - Intronic
918507404 1:185271838-185271860 TATGTCACTGGCAGGGAGGAGGG - Intronic
919523696 1:198621205-198621227 CTTTCCAGTGGCTGGGTAGAGGG - Intergenic
921411645 1:214842427-214842449 GTTGCCAGGGGCTGGGGGGAAGG - Intergenic
922053203 1:222014919-222014941 GTTGCCAGGGGCTGGGGGGAGGG - Intergenic
922304402 1:224331456-224331478 GTTGCCAGGGGCTGGGGGGAGGG - Intergenic
922790917 1:228310558-228310580 TGGATCAGTGGGTGGGTGGATGG - Intronic
923157544 1:231291849-231291871 TTTCTCAGTGGCAGGGGAGAAGG - Intergenic
923295458 1:232590643-232590665 TTTGTGTGTGGCTGGTTGCATGG - Intergenic
923475331 1:234326292-234326314 GTTGCCAGTGGCTGGGGAGAGGG + Intergenic
924154220 1:241159502-241159524 TAGGTGAGTGGGTGGGTGGATGG - Intronic
924588610 1:245381736-245381758 TTTGCCAGGGGCTGGTGGGAGGG - Intronic
1062943673 10:1444158-1444180 TGAGTAAGTGGGTGGGTGGATGG - Intronic
1063074922 10:2705459-2705481 TTTGCCAGGGGCTGGGGTGAGGG - Intergenic
1063588986 10:7378028-7378050 TGTGTGTGTGGATGGGTGGATGG + Intronic
1063600135 10:7473839-7473861 GTTGCCAGGGGCTGGGGGGAGGG + Intergenic
1063958270 10:11284885-11284907 TGTGTGGGTGGATGGGTGGATGG + Intronic
1064104744 10:12491484-12491506 GTTGTGAGGGGGTGGGTGGATGG + Intronic
1064314332 10:14240702-14240724 TTTTTCACTGCCTGTGTGGAAGG - Intronic
1065090030 10:22222447-22222469 GTTGCCAGTGGCTGGGGGAAGGG - Intergenic
1065303398 10:24345970-24345992 GTTGCCAGGGGCTGGGAGGATGG - Intronic
1065354292 10:24824294-24824316 GTTGCCAGGGGCTGGTTGGAGGG - Intergenic
1065487853 10:26252187-26252209 TCTATCAGTGGCTGGGTGATAGG + Intronic
1065827029 10:29582043-29582065 TTTATCAGGGGCTGGGCAGAGGG + Intronic
1065829102 10:29598206-29598228 ATTGTCAGGGGCTGGGGGAATGG + Intronic
1065950820 10:30649139-30649161 TTTATCAGGGGCTGGGCAGAAGG - Intergenic
1067347092 10:45444544-45444566 TTTGTCAATAGCTGGGGGGAGGG - Intronic
1068469309 10:57440528-57440550 ATTGCCAAGGGCTGGGTGGAAGG + Intergenic
1068806988 10:61207722-61207744 GTTATCAGAGGCTGGGTGGGAGG + Intergenic
1068964001 10:62893523-62893545 TTAGACAGTGGCTGGGTGGAGGG + Intronic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1069931504 10:71885252-71885274 TTTGTCTCTGGGTGGCTGGAGGG - Intergenic
1070628185 10:78066152-78066174 TTTGTCACTGGGTGGTGGGAGGG - Intergenic
1072006750 10:91258119-91258141 GTTGTCAGGGGATGGGAGGAGGG + Intronic
1072551211 10:96479252-96479274 ATCGCCAGTGGCTGGGAGGAAGG - Intronic
1072969007 10:100000519-100000541 TTTCTCTGTGTCTGGGTGGATGG + Intronic
1073086033 10:100889700-100889722 TTTGTCAGTGTGTGAGTGGGTGG + Intergenic
1073086036 10:100889708-100889730 TGTGTGAGTGGGTGGGTGGATGG + Intergenic
1073391194 10:103177939-103177961 GTTGCCAGGGGCTGGGTAGAGGG - Intronic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1073920634 10:108454205-108454227 TTTATCATTGAGTGGGTGGATGG - Intergenic
1073921242 10:108462397-108462419 GTTGTCAGGGGTTAGGTGGAAGG - Intergenic
1074504864 10:114060583-114060605 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
1074818838 10:117164153-117164175 TTTCTCAGTGGCATGGGGGAGGG + Intergenic
1075380987 10:122018547-122018569 GTTGTCAGGGGCTGGGGGAAGGG - Intronic
1075680904 10:124330555-124330577 TTTGTGGGTGGGTGGGTGGGTGG - Intergenic
1076293341 10:129364899-129364921 TTTGTCCTTGTCTGGGTGTAGGG - Intergenic
1076578017 10:131483745-131483767 TGAGTCAGTGGATGGGTGGATGG + Intergenic
1076648839 10:131973248-131973270 TCTGGCAGGTGCTGGGTGGAAGG - Intronic
1076659315 10:132044801-132044823 GGTGTCAGGGGCTGGGTGGGGGG - Intergenic
1076992927 11:284946-284968 TTTGTCAGAGGCTGGGGGAGGGG - Intronic
1077150294 11:1070125-1070147 TGGGTCAGTGGGTGGGTAGATGG - Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077357837 11:2126963-2126985 TGGGTAAGTGGATGGGTGGAGGG + Intergenic
1077736047 11:4792370-4792392 TTTGTTAGGGGCTGGAGGGAGGG - Intronic
1078400562 11:11022764-11022786 TGGGTGGGTGGCTGGGTGGATGG - Intergenic
1078444021 11:11390650-11390672 CTTGTCAGTGGGGAGGTGGAAGG + Intronic
1078475178 11:11623181-11623203 TATTTCTGTGGCTGGTTGGAAGG - Intergenic
1078519952 11:12054868-12054890 GCTGTCAGGGGCTGGGTGGCAGG - Intergenic
1078635859 11:13049467-13049489 CTTGTCAGAGGGTGGGAGGAGGG - Intergenic
1079113998 11:17629017-17629039 TTTGTCAGATGATGGGTGGATGG + Intronic
1079300942 11:19278504-19278526 TTTGGCAGAGGCTGGGGGGCTGG - Intergenic
1080383265 11:31795925-31795947 TTGGCCAGAGGCGGGGTGGAGGG + Intronic
1080603261 11:33841748-33841770 TATGTTTGTGGCTGGGTGCATGG + Intergenic
1080640910 11:34157763-34157785 ATTGGCAGTGGCTGGGGGGATGG - Intronic
1080826976 11:35856591-35856613 TATGTGTGTGGATGGGTGGATGG + Intergenic
1080901084 11:36491980-36492002 TTTGTCACTGGGTAGATGGAAGG - Intronic
1081514676 11:43815202-43815224 TCTGTCAGTTGCTGGATGGTAGG + Intronic
1081686859 11:45048969-45048991 TTTGTCAGGGACTGGGGGAAAGG + Intergenic
1081854843 11:46296678-46296700 TTCTTCAGGTGCTGGGTGGACGG - Intronic
1083083910 11:60122957-60122979 TTTGTCTCAGGATGGGTGGAGGG + Intergenic
1083201268 11:61122416-61122438 TGGATCAGTGGGTGGGTGGATGG + Intronic
1084199610 11:67546906-67546928 TTTGTCAGTGTCTGGGATAAAGG + Intergenic
1084413461 11:69016971-69016993 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1084545906 11:69815024-69815046 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084596345 11:70119121-70119143 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084699434 11:70776881-70776903 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084792968 11:71486459-71486481 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084945006 11:72633626-72633648 TGTGTCTGTGTCTGGGTGCATGG + Intronic
1085031472 11:73273475-73273497 TGTGTGACTGGCTGGGTGGGTGG + Intronic
1085464302 11:76713595-76713617 TGGGTGGGTGGCTGGGTGGATGG + Intergenic
1085464314 11:76713634-76713656 TTGGTCAGTGGGTGGATGGGTGG + Intergenic
1086865592 11:91976047-91976069 TTTCCCAGTGGCTGCCTGGAGGG + Intergenic
1087064154 11:94011700-94011722 ATTGCCAGGGGCTGGGTGGAGGG + Intergenic
1087080909 11:94170220-94170242 GTTGCCAGGGGCTGGGGGGATGG - Intronic
1087138683 11:94744555-94744577 TATGTGTGTGGCAGGGTGGAGGG + Intronic
1089145093 11:116323268-116323290 TTTCTCAATAACTGGGTGGAGGG + Intergenic
1089167286 11:116486877-116486899 TTTTTCAGGGGCTGGGAGGTGGG - Intergenic
1090734478 11:129598955-129598977 TTTGACTGTGCCTTGGTGGAGGG - Intergenic
1091069724 11:132551652-132551674 TGAGTCAGTTCCTGGGTGGAGGG - Intronic
1091670014 12:2446184-2446206 TATGTAGGTGGGTGGGTGGATGG + Intronic
1091670054 12:2446353-2446375 TATGTGTGTGGGTGGGTGGATGG + Intronic
1091670092 12:2446489-2446511 TGCGTCAGTGGGTGGATGGATGG + Intronic
1091958098 12:4665251-4665273 GTTGCCAGGGGCTGGGGGGAAGG - Intronic
1092038769 12:5364659-5364681 TTTATCAGTGGCTAGCTGGAAGG + Intergenic
1092513533 12:9184199-9184221 GATGTCAGTGGCTGTGTGGTAGG - Intronic
1092546326 12:9454777-9454799 ATTGTCAGGGGCTGGGGGAAGGG + Intergenic
1092913716 12:13171157-13171179 TTTGGCAGTGGGTGGGTGGGGGG + Intergenic
1093099964 12:15015906-15015928 GTTGCCAGGGGCTGGGTGAAGGG + Intergenic
1094506616 12:31067297-31067319 ATTGTCAGGGGCTGGGGGAAGGG - Intergenic
1094696894 12:32828661-32828683 TTTGTCTGTGGCTATGTGCAGGG + Intronic
1095394261 12:41744252-41744274 TTTTTCAGTTGCTGATTGGATGG + Intergenic
1095887689 12:47206059-47206081 TGAGTCAGTTCCTGGGTGGAGGG + Intronic
1096611224 12:52803289-52803311 TGAGTGAATGGCTGGGTGGATGG + Intergenic
1097556793 12:61148690-61148712 TCTGTCATGGGCTGGGGGGAGGG + Intergenic
1097824487 12:64160649-64160671 TTTGCCAGTGGCTGGGTCCTGGG + Exonic
1098334902 12:69393536-69393558 GTTGGCAGGGGCTGGGTTGAGGG - Intergenic
1098429672 12:70406110-70406132 GTTATCAGGGGCTGGGAGGAGGG + Intronic
1100272157 12:93036760-93036782 ATTGTCAGGGTCTGGGGGGAAGG - Intergenic
1101210737 12:102533159-102533181 GTTGTCAGGGGCTGGGGTGAGGG + Intergenic
1101270082 12:103133551-103133573 TTTTTCAGTGGCTTGGGGTATGG - Intergenic
1101584864 12:106076831-106076853 GTTGCCAGTGGCTGGGAGGAGGG + Intronic
1101685311 12:107014069-107014091 AATCTCAGTGGCTTGGTGGAGGG - Intronic
1102047416 12:109838446-109838468 GTCGTCAGGGGCTGGGGGGAAGG + Intergenic
1102250913 12:111387024-111387046 GTTGCCAGGGGCTGGGGGGAGGG - Intergenic
1102317208 12:111898837-111898859 TCTGTCAGGGGGTGGGGGGAAGG - Intergenic
1102353723 12:112214698-112214720 TATGTCAGGGGGTGGGTGGTAGG - Intronic
1103393787 12:120592443-120592465 GTTGTCAGCGGCTGGGGGGAGGG - Intergenic
1103444844 12:120988067-120988089 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103444861 12:120988130-120988152 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103444894 12:120988256-120988278 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103665368 12:122560007-122560029 TTTGCCAGGGGCTGGGGAGACGG - Intronic
1104252845 12:127112443-127112465 TTTGTCAGGGGCTGGGGAGAAGG + Intergenic
1104528087 12:129543204-129543226 TTGGTGAGTGGGTGGGTGGGTGG + Intronic
1104803187 12:131568681-131568703 ATGGTGAGTGGGTGGGTGGATGG - Intergenic
1104845120 12:131842918-131842940 GTTGCCAGGGGCTGGGGGGATGG - Intronic
1104925759 12:132313293-132313315 TGTGTGAATGGATGGGTGGATGG - Intronic
1104925765 12:132313321-132313343 TGGGTGAGTGGATGGGTGGATGG - Intronic
1105022372 12:132825682-132825704 TTTTTCAGTGGCCGGGAAGATGG + Intronic
1105282255 13:18973290-18973312 GTTGTCAGGGGCTGGGGGAAGGG + Intergenic
1105405961 13:20132912-20132934 GTTGCCAGGGGCTGGGTGGAGGG - Intergenic
1105419443 13:20239603-20239625 GTCCACAGTGGCTGGGTGGAAGG + Intergenic
1105519079 13:21115461-21115483 GTTGCCAGGGGCTGGGGGGAGGG + Intergenic
1105586019 13:21743476-21743498 TGGGTGAGTGGATGGGTGGATGG - Intergenic
1106037403 13:26056537-26056559 CCTGTCAGGGGCTGGGAGGAAGG + Intergenic
1106799200 13:33239035-33239057 ACTGTCAGTGGCTGGGGGGGAGG - Intronic
1107553808 13:41500222-41500244 GTTGTCTGGGGCTGGGGGGAAGG - Intergenic
1108382383 13:49866948-49866970 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
1108510811 13:51154000-51154022 GTTGTCAGGGGCTGGGGGTAGGG - Intergenic
1108575615 13:51788011-51788033 TTTGTCAGATGGTGGGTGGATGG + Intronic
1108575999 13:51791761-51791783 GTTGTCAGGGGCTGGGGGAAAGG - Intronic
1108903491 13:55442264-55442286 GTTGCTAGTGGCTGGGAGGAGGG + Intergenic
1109443987 13:62408729-62408751 GTTGCCAGGGGCTGGGTGGCGGG + Intergenic
1110047273 13:70845844-70845866 GTTATCAAAGGCTGGGTGGAGGG - Intergenic
1110240188 13:73258210-73258232 TTGGTCTGGGTCTGGGTGGAAGG + Intergenic
1110528353 13:76566626-76566648 GTTGTCAGGGGCTGGGTGGAGGG + Intergenic
1111232730 13:85364356-85364378 TGTGTGGGTGGGTGGGTGGAGGG + Intergenic
1111413914 13:87913564-87913586 TTTCTCAGTTGCTGGGAGGGTGG + Intergenic
1111493861 13:89022421-89022443 TCTGTCAGGGGCTGGGGGGCTGG - Intergenic
1111561419 13:89954053-89954075 GTTTTCAGGGGCTGGGTGGTGGG - Intergenic
1111661165 13:91213689-91213711 GTTGGCAGGGGCTGGGAGGAGGG + Intergenic
1111670949 13:91329359-91329381 TTTGTCCGTGGATGAGTGAAGGG - Intergenic
1112327045 13:98448597-98448619 TTTTTCAGGGGCAGGGTGGAGGG - Exonic
1113553958 13:111216349-111216371 CTTCCCTGTGGCTGGGTGGAGGG + Intronic
1113780188 13:112972348-112972370 TGTGTAAGTGGGTGGATGGATGG + Intronic
1113992162 14:16036168-16036190 TTCGTCAGCAGCTGGGTGGAGGG - Intergenic
1114306565 14:21429055-21429077 AGAGTCACTGGCTGGGTGGAGGG + Exonic
1114385440 14:22249543-22249565 GTTGTCAGGAGCTGGGGGGAGGG - Intergenic
1114453049 14:22838767-22838789 TGTGTCTGCGGCTGGGTGGGAGG - Intronic
1115691137 14:35844634-35844656 TTTGGCAGTGGCTGGCAAGATGG - Intronic
1116051544 14:39809699-39809721 TTTGTCAGGGGCTAGGAGAAAGG + Intergenic
1116566726 14:46455143-46455165 TTTGTCAGAGGCTGGGGGTTAGG - Intergenic
1116655824 14:47652759-47652781 TTTGTGTGTGCCTGGGGGGAGGG - Intronic
1116965659 14:51012236-51012258 GTTGCCAGGGGCTGGGAGGAAGG - Intronic
1117313668 14:54553509-54553531 GTTGTCAGGGGCTGGGAGGAGGG + Intergenic
1117647484 14:57866608-57866630 TTTTTCAGTGGCAGGATGGAGGG - Intronic
1117846127 14:59913624-59913646 TTTGGCATTTGCTGAGTGGATGG + Intergenic
1117916807 14:60686218-60686240 CTTGTCAGAGGCTGGAGGGAGGG + Intergenic
1118369562 14:65125823-65125845 ATTGTCAGGGTCTGAGTGGAGGG + Intergenic
1118934242 14:70271679-70271701 TATGTCATTGGCTGGAAGGAAGG - Intergenic
1119850179 14:77861347-77861369 TTTCCCAGTGTGTGGGTGGAGGG + Intronic
1120546527 14:85819106-85819128 CTTGTGAGTGGCTGGATGAATGG - Intergenic
1120995814 14:90418038-90418060 GTTGCCAGGGGCTGGGAGGAAGG - Intergenic
1120996129 14:90419953-90419975 TTTGTGGCTTGCTGGGTGGAAGG - Intergenic
1121056289 14:90856828-90856850 TTTTTCAGGGGCTGGTGGGAGGG - Exonic
1121696562 14:95917970-95917992 CCTGCCAGGGGCTGGGTGGAGGG - Intergenic
1121778356 14:96605889-96605911 TTGAGAAGTGGCTGGGTGGACGG - Intergenic
1121918384 14:97857061-97857083 TGAGTCAGTGGGTGGGTGGATGG + Intergenic
1122162037 14:99791949-99791971 TTTGACTGTGACTTGGTGGATGG - Intronic
1122270272 14:100565868-100565890 TTTGTCAGTGACTGGGTCTGTGG + Intronic
1122385482 14:101342773-101342795 GTTATCAGGAGCTGGGTGGAAGG + Intergenic
1122528315 14:102406058-102406080 GTTGCCAGGGGCTGGGGGGAGGG + Intronic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122867636 14:104614659-104614681 TGAGTGAGTGGGTGGGTGGATGG + Intergenic
1122923715 14:104890443-104890465 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923777 14:104890683-104890705 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1123406639 15:20023462-20023484 TGTGTGTGTGGATGGGTGGATGG - Intergenic
1123425181 15:20164851-20164873 TTTGTCAGGGGATGAGTGCAAGG + Intergenic
1123515969 15:21030110-21030132 TGTGTGTGTGGATGGGTGGATGG - Intergenic
1123534406 15:21171384-21171406 TTTGTCAGGGGATGAGTGCAAGG + Intergenic
1124656803 15:31515745-31515767 TGTGTGGGTGGGTGGGTGGATGG - Intronic
1125054894 15:35347148-35347170 TTTGTCAGGGGCTGTGTGGAAGG - Intronic
1125086042 15:35730617-35730639 TTTGCCAGGGGCTGGGAAGAGGG - Intergenic
1125532713 15:40424043-40424065 TCTGAGAGTGGCTGGGTGGTGGG - Intronic
1126243429 15:46473181-46473203 TTTATCAGTGCCTGAGTGAAGGG - Intergenic
1126639974 15:50814580-50814602 TTTGCCAGAGGCTGGGGGGTAGG - Intergenic
1127491924 15:59473130-59473152 TTTGCCAGTGGTTGAGGGGATGG - Intronic
1127533034 15:59863732-59863754 TTCTTCACTGGCTGTGTGGAAGG - Intergenic
1128165472 15:65460488-65460510 GTTGTCAGGGACTGGATGGAAGG - Intronic
1128177365 15:65567875-65567897 TTTGCCAGGGGCTGGCTGAATGG + Intronic
1128416863 15:67454571-67454593 TTTTCCAGTGGCTGTGAGGAAGG - Intronic
1129109627 15:73329887-73329909 TTTCTCAGTGGCTGGGCCCAGGG + Intronic
1129375877 15:75131114-75131136 GTTGTCAGGGGCTGGGGAGAGGG - Intergenic
1129759144 15:78118838-78118860 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
1130089759 15:80810840-80810862 TGTGAGAGTGGCTGGTTGGATGG - Intronic
1130660652 15:85829323-85829345 TTTGGAAGTGGCTGTTTGGAAGG + Intergenic
1131010663 15:89015786-89015808 GTTTCCAGAGGCTGGGTGGAAGG + Intergenic
1131016753 15:89064014-89064036 GTTGTCAGGGGCTTGGGGGAGGG - Intergenic
1131193882 15:90339545-90339567 TTTGCCAGGGGCTGGGAGAAGGG + Intergenic
1132241145 15:100257919-100257941 GTTGTCAGAGGCTGGGGAGAAGG - Intronic
1132351427 15:101141938-101141960 TGTGTGAGTGGATGGGTAGATGG - Intergenic
1132653785 16:1033180-1033202 TTGGTGGGTGGATGGGTGGATGG - Intergenic
1132827880 16:1914050-1914072 AGTGGCAGTGGGTGGGTGGAGGG - Intronic
1133191333 16:4135726-4135748 TTGGTTGGTGGTTGGGTGGATGG + Intergenic
1133191340 16:4135749-4135771 TTGGTTGGTGGTTGGGTGGATGG + Intergenic
1133204897 16:4227350-4227372 TGGGTGAATGGCTGGGTGGAAGG + Intronic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1133474573 16:6107718-6107740 TTTGTGGGTGGGTGGGTGGGTGG + Intronic
1133880842 16:9780045-9780067 TTCATCAGTGGCTGTGTGGTTGG - Intronic
1134081906 16:11330646-11330668 ATTGTCAGGGGCTGGGAGCAGGG - Intronic
1134114955 16:11541119-11541141 GTTGTCAGGGGCTGGGAAGAGGG - Intergenic
1134224502 16:12380684-12380706 TTGGTGGGTGGATGGGTGGATGG - Intronic
1134224531 16:12380777-12380799 TGTGTGGGTGGATGGGTGGATGG - Intronic
1134235705 16:12464016-12464038 GTTGCCAGGGGCTGGGGGGATGG - Intronic
1135713410 16:24738456-24738478 GTTGCCAGAGGCTGGGTGGAAGG - Intronic
1135893068 16:26374480-26374502 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1136531524 16:30872985-30873007 TTTGTCAGAGGTTGGGAAGATGG - Intronic
1136556924 16:31012375-31012397 GCTTTGAGTGGCTGGGTGGATGG - Intergenic
1136859679 16:33690894-33690916 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1136911542 16:34148149-34148171 TTCGTCAGCCGCCGGGTGGAGGG - Intergenic
1137283071 16:46994516-46994538 TTTGGCAGTGGTTAGGTGGCGGG + Intergenic
1137488222 16:48909309-48909331 CTGGTCAGAGGCAGGGTGGATGG + Intergenic
1138547695 16:57729459-57729481 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138547717 16:57729535-57729557 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138547738 16:57729607-57729629 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138681633 16:58687767-58687789 GTTGCCAGGGGCTTGGTGGAGGG - Intergenic
1138975543 16:62202827-62202849 TGTGTGTGTGTCTGGGTGGAAGG + Intergenic
1139101279 16:63770463-63770485 TTTGTGTGTGGTTGTGTGGAGGG - Intergenic
1139369378 16:66457192-66457214 TTGGTGAGGGGATGGGTGGATGG + Intronic
1140067671 16:71625328-71625350 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1140919598 16:79525036-79525058 TTTGTCACTGGCTGGGGAGCTGG - Intergenic
1141488188 16:84354966-84354988 TTTGTGGTTGGGTGGGTGGATGG + Intergenic
1142081049 16:88148938-88148960 TCTGGCCGTGGCTGGGTGGCAGG + Intergenic
1142255464 16:89011745-89011767 TGTGTGCGTGGGTGGGTGGATGG - Intergenic
1203121185 16_KI270728v1_random:1539073-1539095 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1142777040 17:2148900-2148922 GTTGTCAGGGGCTGTGGGGAGGG + Intronic
1143160996 17:4870980-4871002 GTTGCCAGGGGCTGGGAGGAAGG - Intronic
1143889432 17:10091227-10091249 GTTGTCAGGGGCTGAGTGGCTGG + Intronic
1144002589 17:11069656-11069678 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
1144155538 17:12496997-12497019 GTTGCCAGTGGCTGAGGGGAGGG - Intergenic
1144553640 17:16263039-16263061 TTTGCCAGGGGTTGGGAGGAGGG + Intronic
1144773639 17:17772996-17773018 TGAGTGAGTGGATGGGTGGATGG + Intronic
1145240183 17:21236417-21236439 TGGGTGAATGGCTGGGTGGATGG - Intergenic
1145254362 17:21314552-21314574 GCTGCCAGTGCCTGGGTGGATGG + Exonic
1145793749 17:27643921-27643943 TGTGGCAGTGGTTGGGTGTAGGG - Intronic
1146604085 17:34243290-34243312 TATGACAGTGGCTGAGTGGCTGG - Intergenic
1146785954 17:35721501-35721523 TTTGTCAGAGGCTGGGGTGGAGG + Intronic
1146798220 17:35797873-35797895 TTTTTCATTGGTTGGTTGGAAGG + Intronic
1147491762 17:40875369-40875391 GTTGTTAGGGGCTGGGAGGAAGG + Intergenic
1147669763 17:42170241-42170263 TATGTCAATGGCTCGGTGGGCGG - Exonic
1147851486 17:43446772-43446794 TTTGCCAGGGGGTGGGCGGAAGG - Intergenic
1148244693 17:46022951-46022973 TTTATGTGTGGATGGGTGGATGG - Intronic
1148569772 17:48659004-48659026 TTTGCCAGTTGCTGATTGGAGGG + Intergenic
1148575737 17:48709710-48709732 TTTTCCAGTGGCTGGGCTGAGGG - Intergenic
1148643483 17:49205545-49205567 GTTGTCAGTGGGTGGATGGATGG - Intronic
1148699746 17:49580249-49580271 TCTGTCTGTGGGTGGGGGGAGGG + Exonic
1148908682 17:50928058-50928080 TGAGTGAGTGGATGGGTGGATGG - Intergenic
1149569611 17:57663158-57663180 TGAGCCAGTGGCGGGGTGGAGGG + Intronic
1149811480 17:59677994-59678016 GTTGTCAGGGGCTGGGAGGAGGG - Intronic
1150317571 17:64182303-64182325 GTTGCCAGGGGCTGGGAGGAGGG + Intronic
1150396630 17:64827284-64827306 ATTGCCAGTGGCTGGGAGAAAGG + Intergenic
1150631384 17:66882754-66882776 TTGGTGAGTGGATGGGCGGATGG + Intronic
1150720800 17:67612644-67612666 TTGGGGTGTGGCTGGGTGGATGG + Intronic
1151207436 17:72518315-72518337 TTTGGCAGGGGCTGGAGGGAAGG + Intergenic
1151391883 17:73792990-73793012 TTTGTCATAGGCCGGGTTGATGG - Intergenic
1151431753 17:74068163-74068185 GTTGTCAGGGGCTGGGGGGAAGG + Intergenic
1151525173 17:74660528-74660550 GTTGCCAGAGGCTGGGTGGAAGG + Intergenic
1151973386 17:77470674-77470696 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1152034034 17:77861065-77861087 TTGGTCAATGGGTGGATGGACGG + Intergenic
1152068320 17:78123368-78123390 TGTGTGGGTGGATGGGTGGATGG + Intronic
1152120718 17:78416674-78416696 TTTGCCTGTGGGAGGGTGGAGGG + Intronic
1152141621 17:78540476-78540498 TGTGTGAGTGGGTGGGTGGATGG + Intronic
1152141637 17:78540520-78540542 TGGGTGAGTGGATGGGTGGATGG + Intronic
1152141920 17:78541370-78541392 TGTGTAAGTGGATGGATGGATGG + Intronic
1152345376 17:79747921-79747943 TGTGTCTGTGTCTGGGTGGGGGG - Intergenic
1153489593 18:5633101-5633123 TTTGGTAGAGGCTGGGTGGCGGG - Intergenic
1153635590 18:7110174-7110196 TTTGGCAGCGGGTGGGGGGATGG - Intronic
1153810204 18:8745897-8745919 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
1154212120 18:12388678-12388700 ATTGCCAGGGGCTGGGGGGATGG + Intergenic
1154377614 18:13822952-13822974 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377666 18:13823114-13823136 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377681 18:13823166-13823188 TGGGTCAGTGGGTGGATGGATGG - Intergenic
1154377700 18:13823226-13823248 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377717 18:13823282-13823304 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1154377732 18:13823329-13823351 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1154379307 18:13835445-13835467 CTGGTCTGTGGCTGGGGGGATGG + Intergenic
1155057070 18:22194321-22194343 GTTGTCTGTGGGAGGGTGGAGGG + Intronic
1155918870 18:31583026-31583048 GTTGCCAGGGGCTGGGAGGAAGG + Intergenic
1156652562 18:39241705-39241727 GTTGTCAGGGGCTGGGTGGAGGG + Intergenic
1157202239 18:45668962-45668984 TTTTTGAGTGGCTGTGTGCATGG - Intronic
1157429679 18:47614370-47614392 TGTGTCATTGGCTGGCTGGCTGG + Intergenic
1157501090 18:48191223-48191245 AGTGTCTGTGGCTGGGAGGATGG + Intronic
1157520094 18:48339478-48339500 TTTCTCAGTAGCTCTGTGGAGGG + Intronic
1157551634 18:48585815-48585837 GTGCTCAGTGGCTGGGTCGACGG - Intronic
1158023640 18:52870692-52870714 TGAGTCAGTTGCTGGGTGGGGGG - Intronic
1158392955 18:57058551-57058573 TTCGTCTCTGGCAGGGTGGAGGG - Intergenic
1158409113 18:57188851-57188873 TCTATCACTGGCTGGCTGGAAGG - Intergenic
1158693843 18:59685491-59685513 TTTGTCAGAAGCTGGGTAAATGG - Intronic
1158852358 18:61507819-61507841 TTTTTAAGTGGCTGGGTAGAAGG - Intronic
1158854090 18:61525076-61525098 TTTGCCAGGGGCTGGGTGGGAGG + Intronic
1158898930 18:61943379-61943401 GTTGCCAGTGGCTGGGGGTAGGG - Intergenic
1158974453 18:62698438-62698460 TTTGTCAGGGGCTGGGAGTTGGG - Intergenic
1159275512 18:66215802-66215824 TTTGTCTGGGGCTGGGTTGAGGG - Intergenic
1160399273 18:78598054-78598076 TTCCCCAGTGGCAGGGTGGAAGG + Intergenic
1160687437 19:443343-443365 TGTGTAGGTGGATGGGTGGATGG + Intronic
1160687493 19:443551-443573 TGTGTAGGTGGATGGGTGGATGG + Intronic
1160687626 19:444022-444044 TGTGTAGGTGGATGGGTGGATGG + Intronic
1160921528 19:1523179-1523201 TGTGTCCCAGGCTGGGTGGAAGG + Intergenic
1161049642 19:2156336-2156358 TTGATATGTGGCTGGGTGGATGG - Intronic
1161049879 19:2157597-2157619 TGGGTTAGTGGGTGGGTGGATGG - Intronic
1161242734 19:3231546-3231568 TTTGTAGATGGGTGGGTGGATGG + Intronic
1161242742 19:3231578-3231600 TTTGTAGATGGGTGGGTGGATGG + Intronic
1161380314 19:3961354-3961376 GCTGTCAGTGGCGGGGTGGGGGG - Intronic
1161565488 19:4999817-4999839 TGGGTCGGTGGGTGGGTGGACGG - Intronic
1161750275 19:6091034-6091056 TTTGCCAGGGGCTGGGAGTAGGG + Intronic
1161901146 19:7120593-7120615 GTTGTGTGTGGATGGGTGGATGG - Intronic
1161933783 19:7358352-7358374 TGTATGAGTGGATGGGTGGATGG - Intronic
1161955359 19:7491192-7491214 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1162388837 19:10377509-10377531 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1163095002 19:15050819-15050841 TGTGTGAGTGGGTGGATGGATGG + Intronic
1164068297 19:21741234-21741256 TTTGTCAAGGGCTGGGGAGAGGG + Intronic
1164597933 19:29542320-29542342 TGTGTGAGTGGGTGGATGGATGG + Intronic
1164718200 19:30409066-30409088 TTTGTGGGTGGATGGATGGATGG - Intronic
1165116970 19:33534321-33534343 TTTGCCAGTGGGTGGGTAGGTGG + Intergenic
1165150520 19:33757667-33757689 CTTGTCAGTGGCTGGCTGTGGGG - Intronic
1165322476 19:35094494-35094516 TTTGTGAGTGGATGGATGGAAGG - Intergenic
1165602093 19:37063098-37063120 TTTGTGATTGGATGGATGGATGG - Intronic
1165759154 19:38310403-38310425 TTGGTGAGTGGATGGATGGATGG - Intronic
1166201519 19:41240445-41240467 TTTGTGAGTGGATGAATGGATGG + Intronic
1166441765 19:42821957-42821979 GTTGTCAGCGGCTGGAGGGAGGG + Intronic
1166449898 19:42889937-42889959 GTTGTCAGCGGCTGGAGGGAGGG + Intronic
1166461199 19:42990243-42990265 GTTGTCAGTGGCTGGAGGGAGGG + Intronic
1166478493 19:43150222-43150244 GTTGTCAGTGGCTGGAGGGAGGG + Intronic
1166501150 19:43342527-43342549 GTTGTCAGTGGCTGGAGGGAGGG + Intergenic
1166628216 19:44380504-44380526 GCTGCCAGTGGCTGGGAGGAGGG + Intronic
1166740458 19:45111700-45111722 TCTGCCTGTGGGTGGGTGGAGGG + Intronic
1166932155 19:46308055-46308077 TTGCTCAGTGGGTGGATGGATGG + Intronic
1167387507 19:49172442-49172464 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387517 19:49172512-49172534 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387525 19:49172576-49172598 ATTGTCAGTGGATGCATGGATGG - Intronic
1167387545 19:49172724-49172746 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387553 19:49172788-49172810 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387563 19:49172858-49172880 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387573 19:49172928-49172950 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387582 19:49172992-49173014 ATTTTCAGTGGATGTGTGGATGG - Intronic
1167387590 19:49173056-49173078 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387598 19:49173120-49173142 ATTGTCAGTGGATGCATGGATGG - Intronic
1167387615 19:49173268-49173290 ATTGTCAGTGGATGTGTGGATGG - Intronic
1167387626 19:49173342-49173364 ATTGTCAGTGGATGTGTGGATGG - Intronic
1168716886 19:58534197-58534219 ATTGTCAGGGGCTGGTTGGAGGG + Intronic
925347843 2:3183189-3183211 TGGGTGAGTGGATGGGTGGATGG - Intergenic
925429402 2:3778161-3778183 TTCCTGAGTGGCTGTGTGGACGG + Intronic
926669793 2:15565650-15565672 TTTAGCAGTGGCTGTGAGGATGG - Intergenic
927061577 2:19427660-19427682 TTTTTCAGTGTCTGCCTGGAAGG + Intergenic
928343578 2:30468691-30468713 GTTGCCAGAGGCTGGGTAGAAGG - Intronic
928955838 2:36866353-36866375 AAAGTCAGTGGCTGGGTGCAGGG - Intronic
929488220 2:42373756-42373778 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
930003744 2:46879813-46879835 ATGGTGAGTGGATGGGTGGATGG + Intergenic
930930381 2:56875010-56875032 TTTGTCAGTGCATGTGTGCATGG + Intergenic
931646920 2:64431878-64431900 TTTGCAAGATGCTGGGTGGATGG + Intergenic
932164131 2:69490641-69490663 GTTGCCAGGGGCTGGGGGGAGGG + Intronic
932359692 2:71093760-71093782 TTTATTTGTGGCTGGGGGGAGGG - Intergenic
932453297 2:71829886-71829908 TTTGCCTGTGGGTAGGTGGATGG - Intergenic
932790478 2:74650466-74650488 TCAGTCAGTGGCTGGGAAGATGG - Intergenic
933466093 2:82654237-82654259 TATTTAAGTGGCTGGGTGCAGGG - Intergenic
934341353 2:92271219-92271241 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
934458037 2:94192003-94192025 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
934612776 2:95753246-95753268 TTTGCAAGTGGGTGGGTGGCTGG + Intergenic
934648134 2:96071177-96071199 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
934841513 2:97627007-97627029 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
934932875 2:98442589-98442611 TTTGTCTTGGGGTGGGTGGAAGG + Intergenic
936126532 2:109793177-109793199 ATTGCCAAGGGCTGGGTGGAGGG - Intronic
936218161 2:110578291-110578313 ATTGCCAAGGGCTGGGTGGAGGG + Intergenic
936279775 2:111128104-111128126 GTTGTCAGAAGCTGGGGGGAGGG - Intronic
936326450 2:111509716-111509738 GTTGTCAGGGGCTGGGGGGGAGG + Intergenic
936826984 2:116593770-116593792 ATTGACAGGAGCTGGGTGGAGGG - Intergenic
936973242 2:118194833-118194855 ATTGTCAGGGGCTGGGGGTAGGG + Intergenic
937481693 2:122268212-122268234 GTTGTCAGGGCCTGGGAGGAGGG - Intergenic
937641251 2:124214233-124214255 CTTGTAAGTGGCTTGGTGGGAGG - Intronic
937977081 2:127588820-127588842 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977142 2:127589040-127589062 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977147 2:127589064-127589086 TATGTAAGTGGATGGGTGAATGG + Intronic
937977153 2:127589088-127589110 TGTGTCGATGGTTGGGTGGATGG + Intronic
937977388 2:127589889-127589911 TGTGTGAGTGGATGGGTGAAGGG + Intronic
938048633 2:128146767-128146789 TTTGCCAATGGCAGGGTGGCTGG - Intronic
938246303 2:129780311-129780333 TTTGGCAGAGGCTGTGTGGCCGG - Intergenic
938545375 2:132324661-132324683 GTTGCCAGTGGCTGGGAGCAGGG - Intergenic
938908714 2:135864784-135864806 GTTATCAGTGGCTGGGGGAATGG - Intronic
939629273 2:144514878-144514900 CAAGTTAGTGGCTGGGTGGAGGG + Intronic
940650040 2:156433424-156433446 TAAGTCAGTTCCTGGGTGGAGGG - Intergenic
940875779 2:158895818-158895840 GTTGTCAGGGACTGGGTAGAAGG - Intergenic
941842599 2:170103035-170103057 CCTGTCAGGGGCTGGGGGGAGGG - Intergenic
942629779 2:177942877-177942899 GTTGCCAGGGGCTGGGAGGAGGG - Intronic
943514102 2:188862897-188862919 TTTGACTGTCCCTGGGTGGAGGG - Intergenic
943600837 2:189919224-189919246 GTTGCCAGTGGCTGGGGGAAGGG + Intronic
943986348 2:194624547-194624569 TTTTTCACTGGCTTGTTGGAGGG + Intergenic
945385327 2:209191689-209191711 GTTGCCAAGGGCTGGGTGGAGGG + Intergenic
945671455 2:212807112-212807134 TTTGTCAGTGGCTAGGTGGTTGG - Intergenic
945688623 2:213005175-213005197 TTTGGGAGTGGTTGGGTGGGGGG + Intronic
946390690 2:219415070-219415092 TTTACCAGGGGCTGGGAGGAGGG + Intergenic
947168133 2:227283489-227283511 CTGGTCAGGGGCTGGGAGGATGG + Intronic
947397125 2:229697328-229697350 GTTGCCAGTGACTGGGAGGAGGG + Intronic
947458673 2:230282926-230282948 TTTGTGTGTGGCTGGGGAGAGGG + Intronic
947862420 2:233370140-233370162 GTTGTCAGCAGCTGGGAGGAGGG - Intronic
948008124 2:234627554-234627576 TTTGCCAGAGGCTGGGTAAAGGG - Intergenic
948057457 2:235019194-235019216 TTTGTTGGTGGGTGGGTGGAGGG + Intronic
948170295 2:235896110-235896132 GTTGCCAGGGGCTGAGTGGAGGG - Intronic
948282842 2:236761391-236761413 ATTGTCAGTGGCTGGGAATATGG - Intergenic
948375310 2:237517042-237517064 TAGGTAAGTGGATGGGTGGATGG + Intronic
948531919 2:238614514-238614536 TGTGTGGGTGGTTGGGTGGATGG - Intergenic
948726506 2:239937376-239937398 GTTGCCAGGGGCTGGGAGGAAGG - Intronic
948815673 2:240509198-240509220 TGGGTGAGTGGATGGGTGGATGG + Intronic
1168818539 20:757586-757608 TTTGTGAAGGACTGGGTGGAGGG - Intergenic
1169481240 20:5983410-5983432 TTTCTCAGTGGCTGGGCGGGTGG + Intronic
1169585859 20:7084605-7084627 TTTGCCGGTGGCTGGGGGCAGGG - Intergenic
1169786172 20:9361465-9361487 TTTATCAATGGCTGGGAGGAGGG + Intronic
1170238771 20:14138606-14138628 ATTGCCGGTGGCTGGGTGGGGGG + Intronic
1170393332 20:15900053-15900075 TTTGTGAGTGGCTGGACAGAAGG + Intronic
1170526403 20:17242310-17242332 TTTGTAAGAGGCTGTGTGGAAGG - Intronic
1170583093 20:17713420-17713442 TTTGTCAGGGGCTATGAGGAGGG + Intronic
1170853419 20:20024737-20024759 TATGTCAGTGGCTGGCTGGCAGG + Intronic
1171402747 20:24888943-24888965 GTTGCCAGGGGCTGGGGGGAGGG + Intergenic
1171769691 20:29313095-29313117 TTCGTCAGCTGCCGGGTGGAGGG + Intergenic
1171874231 20:30557420-30557442 GTTGCCAGTGGCTGGGAGCAGGG - Intergenic
1171906867 20:30906424-30906446 TTCGTCAGTCGCCGGGTGGAGGG - Intergenic
1172667517 20:36610867-36610889 GTTGCCAGTGGCTGGGAGGAGGG + Intronic
1172779900 20:37430339-37430361 TGAGTGAGTGGGTGGGTGGATGG - Intergenic
1172998092 20:39085425-39085447 TTTGTTACTGGCTGGATGAATGG - Intergenic
1173244257 20:41324388-41324410 GTTGCCAGGGGCTGGGGGGAAGG + Intergenic
1173319874 20:41977749-41977771 ATTGTCAGTGTCTTGGTGGAAGG + Intergenic
1173677637 20:44851234-44851256 GTTGCCAGGGGCTGGGTGGAGGG + Intergenic
1173974818 20:47179275-47179297 TGTGTGGGTGGATGGGTGGATGG + Intronic
1174302379 20:49592083-49592105 TGTGTGGGTGGGTGGGTGGATGG - Intergenic
1174510711 20:51050210-51050232 GTTGCCAGGGGTTGGGTGGAGGG + Intergenic
1174564507 20:51455709-51455731 TTGGTGGGTGGGTGGGTGGATGG + Intronic
1174690763 20:52502191-52502213 TTTGTGGGTGAGTGGGTGGATGG + Intergenic
1174776537 20:53347983-53348005 GTTATCAGGGGCTGGGAGGAGGG - Intronic
1175094413 20:56530112-56530134 TGGGTTAGTGGGTGGGTGGATGG - Intergenic
1175193626 20:57227587-57227609 TTACTCAGTGGCTGGGTTGCTGG - Intronic
1175375323 20:58520011-58520033 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1175526632 20:59638882-59638904 TGGGTGAGTGGATGGGTGGATGG + Intronic
1175623005 20:60466619-60466641 TTTGTCAGTGTCTGGCCAGATGG + Intergenic
1175742426 20:61429536-61429558 TGTGTGAGTGGATGGATGGATGG + Intronic
1175901170 20:62360430-62360452 TGGGTGAGTGGGTGGGTGGAGGG + Intronic
1176026714 20:62989756-62989778 TGTGTCAGTGGCTGGGAGGATGG - Intergenic
1176092147 20:63322950-63322972 TAGGACAGTCGCTGGGTGGAAGG + Intronic
1177017460 21:15809977-15809999 GTTGCCAGAGGCTGGGGGGAGGG + Intronic
1177522841 21:22251955-22251977 TGTGTGAGTGTGTGGGTGGATGG + Intergenic
1177528644 21:22331942-22331964 TTTCTGAGTGGTTGGGGGGATGG + Intergenic
1178500721 21:33123691-33123713 TTTGTCAGTGGCTGGGTGGAGGG - Intergenic
1178500918 21:33124881-33124903 AATGTCAGTGGCCGGGTGGAGGG + Intergenic
1178628089 21:34235030-34235052 ATTGTCAGGGGCTGGGAGGAGGG + Intergenic
1179017277 21:37604920-37604942 TGGGTCAATGGATGGGTGGATGG - Intergenic
1179079861 21:38160739-38160761 GTTGGCAGTGGTTGGGTGGGGGG + Intronic
1179118883 21:38524079-38524101 TTTGTAAATGGGTGGGTTGAAGG - Intronic
1179179203 21:39030951-39030973 GTTGTCAGGGGCTGGGGGGAGGG + Intergenic
1179382685 21:40914050-40914072 GTGGGCTGTGGCTGGGTGGAAGG + Intergenic
1179937840 21:44616384-44616406 TGTGTCTGTGGTTGTGTGGAAGG - Intronic
1180025156 21:45156603-45156625 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1180086046 21:45508355-45508377 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180086068 21:45508444-45508466 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180182485 21:46124199-46124221 TTAGTGGGTGGCTGGGTGGATGG + Intronic
1180315109 22:11271349-11271371 TTCGTCAGCAGCTGGGTGGAGGG + Intergenic
1180340276 22:11612502-11612524 TTCGTCAGCCGCCGGGTGGAGGG - Intergenic
1180600784 22:17013917-17013939 CTTGCCTGGGGCTGGGTGGAAGG + Intergenic
1180754171 22:18148861-18148883 TTTGTCTGTTGCTGCGGGGACGG + Intergenic
1181002658 22:19995081-19995103 TTTGTGGGTGGGTGGCTGGAGGG + Intronic
1181358171 22:22314425-22314447 TTTGTCAGGGGATGAGTGCAAGG + Intergenic
1182009418 22:26987752-26987774 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1182014571 22:27028890-27028912 GTTGCCAGTGGCTGTGGGGAGGG + Intergenic
1182069269 22:27452117-27452139 TAGATGAGTGGCTGGGTGGATGG + Intergenic
1182896002 22:33859947-33859969 CTTGCCAGGGGCTGGGAGGAGGG + Intronic
1183077875 22:35438223-35438245 TATGTGGGTGGGTGGGTGGATGG - Intergenic
1183078063 22:35439123-35439145 TATGTGAGTGGATGGATGGATGG - Intergenic
1183127423 22:35797754-35797776 TTTTTCAGAGTCTGGGTCGAGGG - Intronic
1183254924 22:36756182-36756204 TTTGTCAGTACCTGGCTGGCTGG + Intergenic
1183850473 22:40582621-40582643 TTCGTCTGTGGCTGTATGGAAGG - Intronic
1184320935 22:43741789-43741811 TCTGCCCGTGGCTGGATGGAGGG - Intronic
1184382846 22:44156858-44156880 GTTCTCAGGGGCTGGGGGGAAGG + Intronic
1184444554 22:44539705-44539727 TGGGTCAGTGGATGGATGGATGG + Intergenic
1184444562 22:44539744-44539766 TGGGTCAGTGGATGGATGGATGG + Intergenic
1184609701 22:45594839-45594861 TTGCTGAGTGGGTGGGTGGATGG + Intronic
1184653362 22:45929424-45929446 TGGATCAGTGGGTGGGTGGATGG - Intronic
1184864833 22:47196298-47196320 CCTCTCAGTGTCTGGGTGGAAGG + Intergenic
949751104 3:7353629-7353651 TTTCTCAGTGGATTGGTGAAAGG - Intronic
949809653 3:7992537-7992559 TTGTTGAGTGGATGGGTGGATGG - Intergenic
950203006 3:11057882-11057904 TTGGTGAATGGATGGGTGGATGG + Intergenic
950269464 3:11602094-11602116 TTTGTAAGGGGCTGGCTGGGCGG - Intronic
951355740 3:21664847-21664869 TTTGTCTTTGCCTGAGTGGAAGG - Intronic
951955122 3:28244768-28244790 TACGTCAGCAGCTGGGTGGAAGG + Intronic
952255914 3:31695556-31695578 TTGGTTAGTGCCTGGATGGAGGG - Intronic
952420452 3:33126129-33126151 GTTGCCAGTGGCTGGGGGGAAGG - Intronic
953146479 3:40280692-40280714 TTTGTCAGTGTGTTGGGGGAGGG + Intergenic
953332680 3:42066860-42066882 TTTTTCAGGGGCTGGGGGGAGGG + Intronic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
954127571 3:48540468-48540490 TGGGTCAGTGCCTGGCTGGATGG - Intronic
954567540 3:51611198-51611220 TTTGGCAGTGCCTGGAAGGAAGG + Intronic
955007876 3:54986731-54986753 CTTGTGAGTGGGTGGGTGGGTGG - Intronic
955577863 3:60386225-60386247 GTAGTCAGTGGGTGGGAGGAGGG - Intronic
956748384 3:72327488-72327510 TTGGTGAGTGGATGGATGGATGG - Intergenic
957173288 3:76768350-76768372 TTTGTCAGTAACAGGATGGAAGG - Intronic
958067864 3:88567680-88567702 ATTGTCAGTGGCTGGGAGAAGGG + Intergenic
958659511 3:97048270-97048292 TTGGGCAGTGGCTTGTTGGAAGG + Intronic
958703438 3:97622256-97622278 TTTGCCAGGGGCTGGGGGAAGGG - Intronic
959582951 3:108000584-108000606 GTTGTCAGGGGCTAGGGGGAGGG + Intergenic
960954696 3:123023916-123023938 TTTGTCACTGCCTGGGTACAGGG - Intronic
961118131 3:124349301-124349323 GTTGTCAGAGGCTGGGGGAAGGG + Intronic
961197856 3:125018350-125018372 ATTGCCAGGGGCTGGGAGGAGGG + Intronic
961315259 3:126030720-126030742 TGGGTGAGTGGCTGGGTTGATGG + Intronic
961572081 3:127806434-127806456 TTGGTGAATGGATGGGTGGAAGG + Intronic
961661225 3:128469828-128469850 TATGTGAGTGGCTGGGTGTGTGG - Intergenic
961661242 3:128469892-128469914 TGTGTGGGTGGCTGGGTGGGTGG - Intergenic
961661268 3:128469968-128469990 TGTATGAGTGGCTGGGTGGCTGG - Intergenic
961661303 3:128470072-128470094 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661326 3:128470144-128470166 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661342 3:128470200-128470222 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961929548 3:130518170-130518192 TTTGCCAGTGGATGGGTGTGGGG + Intergenic
963007965 3:140743824-140743846 TTTGCCAGGGGCTGGGGAGAAGG + Intergenic
963101014 3:141603752-141603774 GTTGTCAGAGGCTGGGAGAAGGG - Intronic
963158951 3:142130420-142130442 GTTATCAGTGGCTGGGAGGAAGG + Intronic
963286883 3:143442049-143442071 TTGATGAGTGGGTGGGTGGATGG - Intronic
963374652 3:144448747-144448769 GTTGTCAGGGGCTGGATGGCAGG - Intergenic
963405525 3:144858401-144858423 GTTTTCAGTGGCTGAGAGGAAGG + Intergenic
964291335 3:155184410-155184432 ATTGTCAGTTTCTGGGTAGAAGG - Intergenic
965541225 3:169873085-169873107 TTTGCCAGGGGCTAGGGGGAGGG + Intergenic
966566511 3:181388233-181388255 GTTGTCAGTGGCTAGGGGTAGGG - Intergenic
966594177 3:181711712-181711734 TTTCTCAGTGGCTGGCAGGCTGG + Intergenic
966758334 3:183392431-183392453 CTTGTCGGGGGCTGGGGGGATGG - Intronic
966918823 3:184599417-184599439 TGTGTCAGTGTGAGGGTGGATGG + Intronic
968531271 4:1093026-1093048 TAGGGCAGAGGCTGGGTGGATGG + Intronic
968536923 4:1137913-1137935 TTTGTCATGGGCTGGGGGGAGGG - Intergenic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
968924780 4:3541493-3541515 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
968924824 4:3541666-3541688 TTGGTAGGTGGATGGGTGGATGG + Intergenic
968928151 4:3560809-3560831 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
969153813 4:5192872-5192894 GGTGCCAGGGGCTGGGTGGAGGG - Intronic
969333457 4:6493203-6493225 CTTGTGTGTGGGTGGGTGGATGG - Intronic
969424891 4:7118395-7118417 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424899 4:7118441-7118463 TTGGTGAGTGGATGGATGGAAGG + Intergenic
969424927 4:7118582-7118604 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424938 4:7118625-7118647 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969424970 4:7118773-7118795 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969501647 4:7556935-7556957 TATGTGAGTGAGTGGGTGGATGG - Intronic
969510374 4:7614266-7614288 TGGGTGAGTGGATGGGTGGATGG - Intronic
969524089 4:7695437-7695459 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524137 4:7695585-7695607 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524198 4:7695793-7695815 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524241 4:7695925-7695947 TTGGTGGGTGGGTGGGTGGATGG + Intronic
971075328 4:23141400-23141422 TTTGTATGTGTCTGGGGGGAAGG + Intergenic
971198597 4:24492104-24492126 TGTGTGAGTGACTGGATGGATGG + Intergenic
971280246 4:25237358-25237380 TTTGGCAGTGGGTGGCTGTAGGG + Intronic
971636205 4:29061903-29061925 GTTGTCAGTGGGTGGGAGGATGG - Intergenic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
972869729 4:43282695-43282717 CTTGGTAGTGGCTGGCTGGAAGG + Intergenic
973825753 4:54705351-54705373 TTTTTTAGTGGCTGGGAGGAGGG + Intronic
974124385 4:57677611-57677633 GTTGTCAGGGGCTGGGAGGAGGG - Intergenic
974149989 4:57994185-57994207 TCTGTTAGTGCCTGGGTGCAAGG + Intergenic
975107765 4:70587887-70587909 GTTGCCAGAGGCTGGGGGGAGGG + Intergenic
975318967 4:72988442-72988464 TTTCTCAGAGCCAGGGTGGAAGG - Intergenic
975474575 4:74808586-74808608 TTTTTCAGTGGCTGGTTTCATGG - Intergenic
976523027 4:86052332-86052354 GTTTTCAGTGGATGGGGGGAGGG - Intronic
977283791 4:95075860-95075882 TGTGAGAGTGGCTGGATGGAAGG - Intronic
978686387 4:111449910-111449932 TTTCTCAGAGGCTGGCAGGAAGG - Intergenic
978963438 4:114712176-114712198 TGTGTCATTGGCTGAGTGGTTGG + Intergenic
979143393 4:117207399-117207421 TTTGCCAGTGGCTGGAAAGAGGG + Intergenic
979635573 4:122951732-122951754 CCTGTCAGTGGATGGCTGGATGG + Intronic
980040580 4:127934934-127934956 GTTGTTAGTGGGTGGGTGGGGGG + Intronic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
980642066 4:135594404-135594426 GTTGTCAGGGGCTTGGGGGAGGG - Intergenic
981166884 4:141570412-141570434 TTTCTCAGTAGCTGTGTGTAAGG + Intergenic
981592656 4:146381551-146381573 TTTTTCTTTGGCTGGGTGGAGGG - Intronic
981918383 4:150059681-150059703 GTTGCCAGGGGCTGGGTAGAGGG + Intergenic
981966386 4:150608763-150608785 ATTGCCAGGGGCTGGGAGGAAGG - Intronic
982342735 4:154320168-154320190 ATTGTCAGAGGCTGGATGGAAGG + Intronic
982415473 4:155126081-155126103 TTTGTCAGGGGTTGTGGGGAGGG + Intergenic
982639208 4:157935981-157936003 TTTGAGAGTGGCTGGGTATATGG - Intergenic
982983650 4:162175696-162175718 GTTGTCAATGGCTGGGGGAAGGG + Intergenic
983631877 4:169857417-169857439 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
984156202 4:176198595-176198617 TTTCTCCTTTGCTGGGTGGATGG + Intergenic
984296855 4:177863195-177863217 TTTGACAGGGGTTGGGTGGGGGG + Intronic
984421387 4:179526794-179526816 GTTGCCAGTGGCTGGGGAGAAGG - Intergenic
985342224 4:188967561-188967583 GTTGTCAGGGGCTGTGGGGAGGG - Intergenic
985560532 5:583947-583969 TGGTTGAGTGGCTGGGTGGATGG + Intergenic
985560568 5:584059-584081 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
985560586 5:584111-584133 TGGGTGAGTGGATGGGTGGACGG + Intergenic
985560609 5:584187-584209 TGGGTAAGTGGGTGGGTGGATGG + Intergenic
985626380 5:991062-991084 TTCCTCTGTGGTTGGGTGGAGGG - Intergenic
985700239 5:1367198-1367220 GTTGTCAGAGGCTGGGGGGAGGG + Intergenic
985703739 5:1388816-1388838 TGTGTAGATGGCTGGGTGGATGG - Intergenic
986769650 5:10960640-10960662 GTTGTCAGGGGCTGGGGGAAGGG + Intergenic
986779607 5:11052638-11052660 TTTGGCAGTGCCTGGGAGGAGGG - Intronic
986853502 5:11840888-11840910 TTTGTCAGTGGCTGCCTGATAGG - Intronic
987160871 5:15140751-15140773 GTTGCCAGGGGCTGAGTGGAGGG + Intergenic
987337380 5:16908949-16908971 GTTGTCAGGGGCTGGGAAGAAGG + Intronic
988509815 5:31855412-31855434 TTTGTCAATGGCTGGACGGAAGG + Intronic
988954196 5:36297943-36297965 TCTGTGAGTGACTAGGTGGAAGG + Intronic
989004068 5:36790148-36790170 GTTGCCAGTGGCTGGGGGAAGGG - Intergenic
989169136 5:38457932-38457954 GTTGTCAGGGGCTGGGGGGAGGG + Intronic
989714261 5:44441713-44441735 TTTCTCAGTGGCTCTGTGAATGG - Intergenic
990862453 5:60341862-60341884 TTAGACAGTGGTGGGGTGGAGGG - Intronic
990898486 5:60725289-60725311 GTTGTCAGGGGCTGGGGAGAAGG - Intergenic
991086763 5:62654818-62654840 TTTGAGGGTGGCTAGGTGGAAGG + Intergenic
991515065 5:67426270-67426292 GTTGCCAGGGGCTGCGTGGAGGG - Intergenic
991936589 5:71808047-71808069 TTTGTTAGTGGCTGGTGGCAGGG + Intergenic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
992317255 5:75569178-75569200 TAAGTAAGTGGATGGGTGGATGG + Intronic
992560027 5:77942354-77942376 GTTGTCAAGGGCTGGGAGGAGGG + Intergenic
993167009 5:84369567-84369589 GTTGTCAGGGGCTGGGAAGAGGG + Intronic
993292907 5:86097903-86097925 GTTGTCATGGGCTGGGGGGAGGG + Intergenic
995585398 5:113643180-113643202 TTTGTCAGGGGGTGGGGGGCAGG + Intergenic
996235989 5:121129381-121129403 TTTTGCAGTGGATGGGTAGATGG - Intergenic
996914173 5:128692499-128692521 ATTGTCAGGGGCTGGAAGGAGGG - Intronic
997544429 5:134694018-134694040 TTTGTCAATTGTTGGGAGGAGGG + Intronic
997659712 5:135579695-135579717 TGTGTGAGTGTCTGGGTGGTGGG + Intergenic
998165591 5:139841052-139841074 ATTGTCAGGGGCTGGAGGGAGGG - Intronic
998481769 5:142468872-142468894 TTTGCCAGGGGCTGGGTGGGGGG + Intergenic
998663902 5:144273758-144273780 GTTGTCAGGGGCTGGGGGGAGGG + Intronic
999186871 5:149717698-149717720 TTTTCCAGTGTCTGGGTAGAGGG + Intergenic
1001516399 5:172358319-172358341 TGTGTCTGTGGGTGAGTGGAGGG + Intronic
1001833694 5:174811618-174811640 TAGGTGAGTGGATGGGTGGATGG - Intergenic
1001855754 5:175009341-175009363 TTTGTGAGTGATTGGATGGATGG + Intergenic
1001855772 5:175009429-175009451 TGGGTCAGTGGATGGATGGATGG + Intergenic
1001961753 5:175883871-175883893 TGTGTCAGTGCCTGGGGGGAGGG + Exonic
1002016689 5:176329578-176329600 TTTGCCAGTAGCTGGGAGGATGG - Intronic
1002084458 5:176763597-176763619 GTTGCCAGGGGCTGGGGGGAAGG - Intergenic
1002838952 6:889335-889357 TTTGTCAGTGGCTGCTTTGATGG + Intergenic
1003331951 6:5136352-5136374 TTTGACTGGGGCTGGGTTGAGGG + Intronic
1003420348 6:5952248-5952270 TTCGTGAATGGCTGGTTGGATGG - Intergenic
1003597212 6:7484734-7484756 TTTGCCAGGGGCTGGGGGAATGG - Intergenic
1004424849 6:15500356-15500378 TGTGTGAGTGAGTGGGTGGATGG + Intronic
1005077731 6:21925073-21925095 TGTGTAAGTTGTTGGGTGGAGGG - Intergenic
1006036057 6:31213253-31213275 GTTGTCAGAGGCTGGGAGGTGGG + Intergenic
1006051502 6:31348464-31348486 TTTGACTCTGGGTGGGTGGAGGG - Intronic
1006783538 6:36649250-36649272 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
1006839799 6:37021513-37021535 TTGGTCAATGGCTGCTTGGAAGG - Exonic
1006921909 6:37632950-37632972 TATGTGGGTGGCTGGGAGGATGG + Exonic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1007481717 6:42154620-42154642 TGTGTGAGTGGATGGATGGATGG - Intergenic
1007890718 6:45287591-45287613 TTTGCCAGGGACTGGGAGGATGG + Intronic
1008190003 6:48443611-48443633 TTCTGCAGTGGCTGGATGGAAGG + Intergenic
1008748635 6:54705061-54705083 GTTGACAGTTGCTGGGTTGAAGG + Intergenic
1008881592 6:56385724-56385746 GTTGTCAGGAGCTGGGAGGAAGG - Intronic
1009428430 6:63540223-63540245 TTTTCTAGTGGCTGGGTGGTAGG - Intronic
1010315780 6:74448467-74448489 TTTGCCAGGGGCTGGAGGGAGGG - Intergenic
1011794156 6:90934328-90934350 TTAGCCTGTGGCTGGCTGGAAGG + Intergenic
1011863015 6:91784620-91784642 TTCATCAGTGGCTGAGTGCAGGG + Intergenic
1012311334 6:97727463-97727485 TATTTCAGTGGCTGGAGGGAAGG + Intergenic
1013073359 6:106749233-106749255 GTTGCCAGTAGCTGGGGGGAGGG + Intergenic
1013361100 6:109394545-109394567 TTGGACAGTGGCTGAGGGGAAGG + Intronic
1013531727 6:111025824-111025846 TTTCTCATTGGGTGGATGGATGG + Exonic
1013599830 6:111693480-111693502 TTTGTCAGTATCTGGGAAGAAGG + Intronic
1014361093 6:120475316-120475338 TTTGTCAGTGGCTGGGTCAGGGG - Intergenic
1014543033 6:122699396-122699418 TTTATCAGTTGCTGATTGGATGG + Intronic
1014720593 6:124913047-124913069 GCTGTCAGGGGCTGGGAGGAGGG - Intergenic
1015466705 6:133556309-133556331 GTTGCCAGAGGCTAGGTGGATGG - Intergenic
1015863554 6:137705214-137705236 TCTTTCAGTGGCTGGCTGGCAGG - Intergenic
1017424665 6:154307897-154307919 TTTGTCAGTGGGTGGATGTGAGG - Intronic
1017821696 6:158053769-158053791 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1018034779 6:159872799-159872821 GTTGCCAGGGGCTGGGTGGAGGG + Intergenic
1018293025 6:162312472-162312494 TTCGTCAGTGACTGGGGTGATGG - Intronic
1019489645 7:1306234-1306256 TGTGTGTGTGGGTGGGTGGATGG - Intergenic
1019489701 7:1306486-1306508 TGTGTGGGTGGGTGGGTGGATGG - Intergenic
1019510663 7:1415858-1415880 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1019546610 7:1580524-1580546 TTTGTCATTAGCTGACTGGATGG - Intergenic
1019704677 7:2491836-2491858 TGTGTGGGTGGGTGGGTGGATGG - Intergenic
1019704837 7:2492647-2492669 TGTGTGGGTGGGTGGGTGGATGG - Intergenic
1020547968 7:9557756-9557778 TTTGTAAGTGGCTGAGTTGCTGG - Intergenic
1021483060 7:21139403-21139425 TTTGTAAGTAGCTGTGTGCATGG + Intergenic
1021645037 7:22781707-22781729 TTGGCCAGTGCCTGGATGGAAGG - Intergenic
1021759760 7:23892223-23892245 TTTGTCAGGGAGTGGCTGGAAGG + Intergenic
1021860859 7:24904831-24904853 GCTGTCAGGGGCTGGGGGGAGGG + Intronic
1022160391 7:27704617-27704639 TTTGCCAGGGGCTGGGGAGAAGG - Intergenic
1023071233 7:36436122-36436144 GTTGTCAGGGGCTCGGGGGAGGG - Intronic
1023907033 7:44530366-44530388 TGTGTCAGGGGCTGAGGGGAGGG + Intronic
1024943783 7:54788583-54788605 TGTGTGGGTGGGTGGGTGGAAGG + Intergenic
1026435761 7:70396214-70396236 TGTGGCAGGGGCTGGGTGAATGG - Intronic
1026828624 7:73598477-73598499 TAGGTGAGTGGTTGGGTGGATGG - Intronic
1026873420 7:73866820-73866842 TTGATCAGTGGGTGGGTAGATGG - Intergenic
1027035905 7:74925128-74925150 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
1027445491 7:78268933-78268955 CTTGTCAGTGGGTGGGGGGCTGG - Intronic
1028855784 7:95591475-95591497 GTTGTCAGAGGCTGTGAGGAAGG - Intronic
1029460123 7:100689484-100689506 GTTGTCACTGGCTGGGAGGGAGG + Intergenic
1029899956 7:104028793-104028815 TATGTCTATGGTTGGGTGGAGGG - Intergenic
1030348577 7:108458427-108458449 TTTCTCAGTGGCCGGGGTGAGGG - Intergenic
1030921969 7:115401885-115401907 CCTGTCAGGGGCTGGGGGGAAGG + Intergenic
1031180397 7:118407390-118407412 GTTGTCAGGGGCTGAGGGGAAGG + Intergenic
1031195289 7:118605787-118605809 GTTGCCAGTGGCTGGGGGGAAGG + Intergenic
1031288407 7:119901188-119901210 GTTGCCTGGGGCTGGGTGGAGGG + Intergenic
1033175983 7:139124119-139124141 GTTGCCAGAGGCTGGGAGGAGGG + Intergenic
1033449010 7:141446413-141446435 TTTGTCATTGGCTTTCTGGATGG + Intronic
1033879466 7:145862860-145862882 TTTGTCTGTTCCTTGGTGGAAGG - Intergenic
1034657037 7:152737822-152737844 TGTGTGTGTTGCTGGGTGGAAGG - Intergenic
1034990239 7:155543327-155543349 TCTGTGAGCTGCTGGGTGGAAGG + Intergenic
1035058464 7:156052074-156052096 TGGGTAAGTGGATGGGTGGATGG - Intergenic
1035117852 7:156539819-156539841 TGTGTGTGTTGCTGGGTGGAGGG - Intergenic
1035318511 7:158013448-158013470 TGTGTGGGTGGATGGGTGGATGG - Intronic
1035318578 7:158013800-158013822 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1035888294 8:3316958-3316980 TGTGTCAGTGGATGTGGGGAGGG + Intronic
1036428965 8:8671957-8671979 TATGTGAATGGATGGGTGGATGG + Intergenic
1036621148 8:10425131-10425153 TTTGGCGGTGGGTGGGGGGATGG + Intronic
1036724065 8:11202961-11202983 TTTGGGAGTGGCAGGGTAGATGG + Intergenic
1036981094 8:13471131-13471153 GTTGTCAGGGGTTGGGGGGAGGG + Intronic
1037430184 8:18803754-18803776 TTTGCCAGGGGCTGGGGGAAAGG + Intronic
1037698348 8:21248203-21248225 GCTGCCAGGGGCTGGGTGGAGGG + Intergenic
1037938506 8:22931396-22931418 GTTGTCAGGGGCTGGGGGTAGGG - Intronic
1038231407 8:25704073-25704095 TGTGTAGGTGGGTGGGTGGACGG - Intergenic
1038257962 8:25968511-25968533 GTTGCCAGTAGCTGGGGGGAGGG + Intronic
1038280742 8:26161987-26162009 TTTGTCGTGGGGTGGGTGGAGGG + Intergenic
1038592878 8:28856665-28856687 TTTGTAAGTTGCTGTTTGGACGG + Intronic
1039775469 8:40732045-40732067 ATTGCCAGGGGCTGGGAGGAGGG + Intronic
1040370998 8:46774281-46774303 GTTGCCAGAGGCTGGGGGGAGGG - Intergenic
1040504104 8:48031459-48031481 TTTGGCAGTGGCTGGGGGTAGGG + Intronic
1040597841 8:48857615-48857637 GTTGCCAGGGGCTGAGTGGAGGG + Intergenic
1040731645 8:50454543-50454565 TGTCTGAGTGGCTGGGTGGCAGG + Intronic
1041421196 8:57668458-57668480 CTTGTCAGGGGCTCTGTGGATGG - Intergenic
1041594529 8:59632995-59633017 TATGTCTGTGGTTGAGTGGATGG + Intergenic
1041684637 8:60632068-60632090 GTTGCCTGGGGCTGGGTGGAGGG - Intergenic
1042359026 8:67861383-67861405 TTTGTCATTGGCTTGGTGCTAGG - Intergenic
1042924114 8:73949563-73949585 TTTGCCAGAGGCTGGGGGGATGG - Intronic
1043346662 8:79305470-79305492 GTTGTCAGAGGCTGGTTGAATGG - Intergenic
1043655215 8:82655845-82655867 TTTTATGGTGGCTGGGTGGAGGG + Intergenic
1043862644 8:85338313-85338335 TTTGGCTGTGGCTGGGTTGTAGG + Exonic
1045373404 8:101548165-101548187 TGTGTGTGTGGGTGGGTGGATGG - Intronic
1046079129 8:109349806-109349828 ATTGTCAGGGGCTGGGGTGATGG - Intergenic
1046478986 8:114789212-114789234 TTTGTGTGTGTGTGGGTGGAGGG + Intergenic
1046517559 8:115283334-115283356 ATTGTCAGGGACTGGGAGGAAGG + Intergenic
1047686082 8:127305821-127305843 TTGTTGAGTAGCTGGGTGGATGG - Intergenic
1048427062 8:134332699-134332721 TTGGTGAATGGATGGGTGGATGG - Intergenic
1048979714 8:139696814-139696836 TTGGTGGGTGGATGGGTGGATGG + Intronic
1049371946 8:142272196-142272218 TGGGTGAGTGGCTGGGTGGATGG - Intronic
1049416123 8:142496142-142496164 TGTGTGGGTGGGTGGGTGGATGG + Intronic
1049983972 9:931022-931044 TTTGGCAGGGGCTGGGAGGGAGG - Intronic
1050001473 9:1081871-1081893 TTTGCCAGGGGCTGGAGGGAGGG + Intergenic
1050660800 9:7880499-7880521 TTTGACTGTCGCTTGGTGGAGGG - Intronic
1050985605 9:12078255-12078277 GTTGTCAGAGGCTGGATAGAGGG + Intergenic
1052002685 9:23306001-23306023 TTTTTCAGGGGATGGGTGGTGGG + Intergenic
1052155567 9:25184607-25184629 GTTGCCAGGGGCTGGGAGGAAGG + Intergenic
1052435508 9:28423004-28423026 GTTGCCAGGGGCTGGGAGGAAGG + Intronic
1053087817 9:35242450-35242472 GTTGCCAGTGGCTGTGGGGAGGG - Intronic
1053688547 9:40567808-40567830 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1053799853 9:41757468-41757490 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1053799870 9:41757539-41757561 TTGGTAGGTGGATGGGTGGATGG + Intergenic
1053803020 9:41775919-41775941 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
1053878078 9:42563531-42563553 GTTGCCAGGGGCTGGGAGGAGGG - Intergenic
1053894582 9:42730836-42730858 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
1054142243 9:61539203-61539225 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054145314 9:61557292-61557314 TTGGTAGGTGGATGGGTGGATGG - Intergenic
1054145358 9:61557465-61557487 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1054188261 9:61969522-61969544 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1054188302 9:61969687-61969709 TTGGTAGGTGGATGGGTGGATGG + Intergenic
1054191309 9:61987229-61987251 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
1054233616 9:62538163-62538185 GTTGCCAGGGGCTGGGAGGAGGG + Intergenic
1054275485 9:63063249-63063271 TTTGTCAGGGGATGAGTGCAAGG + Intergenic
1054299787 9:63368719-63368741 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1054399348 9:64701682-64701704 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1054432928 9:65185947-65185969 TTTGTCAGGGGATGAGTGCAAGG - Intergenic
1054461991 9:65470350-65470372 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054464998 9:65488149-65488171 TTGGTAGGTGGATGGGTGGATGG - Intergenic
1054465103 9:65488582-65488604 TTAGTAAGTGGATGGGTGGGTGG - Intergenic
1054497457 9:65835728-65835750 TTTGTCAGGGGATGAGTGCAAGG + Intergenic
1054647060 9:67600488-67600510 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054650253 9:67619054-67619076 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1055517864 9:77051307-77051329 CTTGTCAGGGGGTGGGGGGAAGG + Intergenic
1055536561 9:77252650-77252672 GTTGTCAGGGGCTGGGTGCAGGG - Intronic
1056293771 9:85170836-85170858 TTAGTCAGTGGTGGGGTGGGTGG - Intergenic
1056628918 9:88276649-88276671 CTTGTCAGTGTGTGTGTGGAGGG - Intergenic
1056682272 9:88730319-88730341 TTGGTGAGTTGGTGGGTGGATGG - Intergenic
1058411429 9:104737473-104737495 GTTGCCAGTGGCTGGGGGAAGGG + Intergenic
1058703021 9:107616294-107616316 TTGGTGGGTGGGTGGGTGGATGG - Intergenic
1058794859 9:108488202-108488224 TCTGGCAGTGGCATGGTGGAAGG - Intergenic
1059906642 9:118993866-118993888 TTAGTGAGAGGCTGGATGGATGG + Intergenic
1060040161 9:120293469-120293491 TTAGTTGGTGGGTGGGTGGATGG + Intergenic
1060074204 9:120577405-120577427 ATTGTCAGAGGCTGGGAGAAGGG + Intronic
1060498651 9:124136258-124136280 TTTGTGGGTGGATGGATGGATGG - Intergenic
1060597083 9:124854991-124855013 GTTGTCAGGGGCTGGGAGGAGGG - Intronic
1060966277 9:127714041-127714063 TGTGGCAGTGGCTGGGTTGGTGG + Exonic
1061055762 9:128222185-128222207 TTCGTCAGTTGCTGGGGGTAAGG - Exonic
1061201314 9:129140071-129140093 TCTGTCAGTAACTGGGGGGATGG - Intronic
1061398679 9:130356887-130356909 TAGATCAGTGGGTGGGTGGATGG + Intronic
1061716010 9:132519261-132519283 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1061846846 9:133392913-133392935 TGGGTCAGTGGATGGATGGATGG + Intronic
1061932171 9:133838824-133838846 TTGGTGAGTGGGTTGGTGGATGG + Intronic
1061938253 9:133870674-133870696 TAAGTCGGTGGGTGGGTGGATGG + Intronic
1061938400 9:133871269-133871291 TAAGTGAGTGGGTGGGTGGATGG + Intronic
1061964019 9:134003225-134003247 TTGGTGGGTGGATGGGTGGATGG - Intergenic
1203363394 Un_KI270442v1:237260-237282 TTCGTCAGCAGCTGGGTGGAGGG + Intergenic
1185495307 X:550067-550089 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1185580960 X:1211334-1211356 TTGGTGGGTGGATGGGTGGATGG + Intronic
1185616281 X:1424058-1424080 TCCATCAGTGGATGGGTGGATGG - Intronic
1185616473 X:1424870-1424892 TGGATCAGTGGATGGGTGGATGG - Intronic
1185624552 X:1473034-1473056 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1185945691 X:4373588-4373610 TAATTCAGTGGCTGCGTGGATGG + Intergenic
1186187276 X:7033578-7033600 TGTGGCAGTGGCTGAGTGTAGGG + Intergenic
1186794329 X:13029902-13029924 ATTGACAATGGCTGGGGGGATGG + Intergenic
1187494815 X:19785907-19785929 GTTGCCAGGGGCTGGGGGGAAGG + Intronic
1187560687 X:20400214-20400236 GTTGTCAGAGGCTGAGGGGAGGG - Intergenic
1187575774 X:20553084-20553106 TTTGCCAGGGGCTGGGTGTGGGG - Intergenic
1187685615 X:21812928-21812950 TTTGTCTCGGGGTGGGTGGAGGG + Intergenic
1188226085 X:27599353-27599375 GTTGCCAGTGGTTGGGAGGAGGG + Intronic
1188682018 X:33020867-33020889 TTTCTCCATGGTTGGGTGGATGG - Intronic
1188986047 X:36769221-36769243 TTTGAAAGTGACTGGGTGTAAGG - Intergenic
1189449786 X:41118290-41118312 GTTGCCAGGGGCTGGGGGGATGG - Intronic
1189738993 X:44099600-44099622 GTTGTCAGAGGCTGGGAGAAGGG - Intergenic
1190245390 X:48687358-48687380 TGGGTGAGTGGATGGGTGGATGG + Intronic
1192111089 X:68365581-68365603 TTTGTTAGTGGCTGAGGGAAAGG - Intronic
1192613825 X:72596277-72596299 GTTGTCAGGGGCTGGGTAGAGGG + Intronic
1194058150 X:89163511-89163533 TTTGTCTGTCCCTTGGTGGAGGG + Intergenic
1195523678 X:105860570-105860592 GTTGCCAGTGGCTGGGGGCAGGG - Intronic
1196698371 X:118638695-118638717 TTTTTAAGAGGCTGTGTGGATGG + Intronic
1196909104 X:120468285-120468307 TTTGTCAGCGTCTGGCTGGGAGG + Intronic
1197948590 X:131869397-131869419 ATTGGCAGGGGCTGGGGGGAGGG + Intergenic
1198116125 X:133546534-133546556 ATTGCCAGTGGCTGGGGGTAGGG + Intronic
1198752693 X:139951386-139951408 TTTTTGTGGGGCTGGGTGGATGG + Intergenic
1199387021 X:147234820-147234842 TATGTGAGTGGGTGGGTGGGTGG - Intergenic