ID: 1178505543

View in Genome Browser
Species Human (GRCh38)
Location 21:33159814-33159836
Sequence ACACATTGCAAGCAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178505539_1178505543 2 Left 1178505539 21:33159789-33159811 CCAAAATGGAGCTCCAATCATGT No data
Right 1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG No data
1178505536_1178505543 18 Left 1178505536 21:33159773-33159795 CCTTCATCCTCATGGTCCAAAAT No data
Right 1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG No data
1178505538_1178505543 11 Left 1178505538 21:33159780-33159802 CCTCATGGTCCAAAATGGAGCTC No data
Right 1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178505543 Original CRISPR ACACATTGCAAGCAGCAGGT GGG Intergenic
No off target data available for this crispr