ID: 1178506948

View in Genome Browser
Species Human (GRCh38)
Location 21:33170207-33170229
Sequence CAGCAGAGGGAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2336
Summary {0: 1, 1: 0, 2: 25, 3: 256, 4: 2054}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178506948_1178506953 -10 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506953 21:33170220-33170242 CCCTCTGCTGCTGTCCATCCAGG 0: 1
1: 0
2: 5
3: 43
4: 464
1178506948_1178506963 25 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506963 21:33170255-33170277 AAGGGAAAAGGTGCACTTGAGGG 0: 1
1: 0
2: 0
3: 20
4: 276
1178506948_1178506960 13 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506960 21:33170243-33170265 TGGATTTTCCTAAAGGGAAAAGG 0: 1
1: 1
2: 4
3: 40
4: 359
1178506948_1178506958 7 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506958 21:33170237-33170259 TCCAGGTGGATTTTCCTAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 183
1178506948_1178506955 -7 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506955 21:33170223-33170245 TCTGCTGCTGTCCATCCAGGTGG 0: 1
1: 0
2: 2
3: 26
4: 218
1178506948_1178506962 24 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506962 21:33170254-33170276 AAAGGGAAAAGGTGCACTTGAGG 0: 1
1: 0
2: 1
3: 24
4: 300
1178506948_1178506957 6 Left 1178506948 21:33170207-33170229 CCTGCCTCCTCCTCCCTCTGCTG 0: 1
1: 0
2: 25
3: 256
4: 2054
Right 1178506957 21:33170236-33170258 ATCCAGGTGGATTTTCCTAAAGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178506948 Original CRISPR CAGCAGAGGGAGGAGGAGGC AGG (reversed) Exonic
Too many off-targets to display for this crispr