ID: 1178507246

View in Genome Browser
Species Human (GRCh38)
Location 21:33171921-33171943
Sequence GAGGAACTCCTGCCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178507243_1178507246 5 Left 1178507243 21:33171893-33171915 CCAAGGAGACAAATGGAGGAAAA No data
Right 1178507246 21:33171921-33171943 GAGGAACTCCTGCCCCAAGGAGG No data
1178507242_1178507246 6 Left 1178507242 21:33171892-33171914 CCCAAGGAGACAAATGGAGGAAA No data
Right 1178507246 21:33171921-33171943 GAGGAACTCCTGCCCCAAGGAGG No data
1178507239_1178507246 13 Left 1178507239 21:33171885-33171907 CCAGGGACCCAAGGAGACAAATG No data
Right 1178507246 21:33171921-33171943 GAGGAACTCCTGCCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178507246 Original CRISPR GAGGAACTCCTGCCCCAAGG AGG Intergenic