ID: 1178508308

View in Genome Browser
Species Human (GRCh38)
Location 21:33180821-33180843
Sequence CCTACCCCAGGGTCACACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178508308_1178508314 -7 Left 1178508308 21:33180821-33180843 CCGGTGTGTGACCCTGGGGTAGG No data
Right 1178508314 21:33180837-33180859 GGGTAGGATTGAGCGGGACCAGG No data
1178508308_1178508317 8 Left 1178508308 21:33180821-33180843 CCGGTGTGTGACCCTGGGGTAGG No data
Right 1178508317 21:33180852-33180874 GGACCAGGAGCCATTGGGCCTGG No data
1178508308_1178508315 2 Left 1178508308 21:33180821-33180843 CCGGTGTGTGACCCTGGGGTAGG No data
Right 1178508315 21:33180846-33180868 TGAGCGGGACCAGGAGCCATTGG No data
1178508308_1178508316 3 Left 1178508308 21:33180821-33180843 CCGGTGTGTGACCCTGGGGTAGG No data
Right 1178508316 21:33180847-33180869 GAGCGGGACCAGGAGCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178508308 Original CRISPR CCTACCCCAGGGTCACACAC CGG (reversed) Intergenic
No off target data available for this crispr