ID: 1178512016

View in Genome Browser
Species Human (GRCh38)
Location 21:33213276-33213298
Sequence TCCCACTGCCTCCTAGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178512012_1178512016 3 Left 1178512012 21:33213250-33213272 CCTCTTCCTCAACATTTCTCATC No data
Right 1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG No data
1178512010_1178512016 30 Left 1178512010 21:33213223-33213245 CCAATCTAGCACCAAATTTTATG No data
Right 1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG No data
1178512011_1178512016 19 Left 1178512011 21:33213234-33213256 CCAAATTTTATGTACTCCTCTTC No data
Right 1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG No data
1178512013_1178512016 -3 Left 1178512013 21:33213256-33213278 CCTCAACATTTCTCATCCACTCC No data
Right 1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178512016 Original CRISPR TCCCACTGCCTCCTAGTCCA GGG Intergenic
No off target data available for this crispr