ID: 1178512114

View in Genome Browser
Species Human (GRCh38)
Location 21:33214267-33214289
Sequence GGGTGAACATACCCCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178512111_1178512114 -5 Left 1178512111 21:33214249-33214271 CCACAATGTCTCCCGGGGGGGTG No data
Right 1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG No data
1178512103_1178512114 6 Left 1178512103 21:33214238-33214260 CCCACAACTTTCCACAATGTCTC No data
Right 1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG No data
1178512102_1178512114 17 Left 1178512102 21:33214227-33214249 CCAATTCTGATCCCACAACTTTC No data
Right 1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG No data
1178512104_1178512114 5 Left 1178512104 21:33214239-33214261 CCACAACTTTCCACAATGTCTCC No data
Right 1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178512114 Original CRISPR GGGTGAACATACCCCACCAC TGG Intergenic
No off target data available for this crispr