ID: 1178513837

View in Genome Browser
Species Human (GRCh38)
Location 21:33229905-33229927
Sequence GCGCCGCGCCGCCGCCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 4, 3: 74, 4: 444}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178513837_1178513846 15 Left 1178513837 21:33229905-33229927 CCGCGCCGGCGGCGGCGCGGCGC 0: 1
1: 1
2: 4
3: 74
4: 444
Right 1178513846 21:33229943-33229965 GCTCCTCGTAGGCCGGGGCTCGG 0: 1
1: 0
2: 1
3: 8
4: 139
1178513837_1178513844 9 Left 1178513837 21:33229905-33229927 CCGCGCCGGCGGCGGCGCGGCGC 0: 1
1: 1
2: 4
3: 74
4: 444
Right 1178513844 21:33229937-33229959 CGTATCGCTCCTCGTAGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 11
1178513837_1178513841 4 Left 1178513837 21:33229905-33229927 CCGCGCCGGCGGCGGCGCGGCGC 0: 1
1: 1
2: 4
3: 74
4: 444
Right 1178513841 21:33229932-33229954 GCTTCCGTATCGCTCCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 14
1178513837_1178513843 8 Left 1178513837 21:33229905-33229927 CCGCGCCGGCGGCGGCGCGGCGC 0: 1
1: 1
2: 4
3: 74
4: 444
Right 1178513843 21:33229936-33229958 CCGTATCGCTCCTCGTAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 16
1178513837_1178513845 10 Left 1178513837 21:33229905-33229927 CCGCGCCGGCGGCGGCGCGGCGC 0: 1
1: 1
2: 4
3: 74
4: 444
Right 1178513845 21:33229938-33229960 GTATCGCTCCTCGTAGGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178513837 Original CRISPR GCGCCGCGCCGCCGCCGGCG CGG (reversed) Intronic
900119198 1:1041342-1041364 GCGCCGCGCCTGCGCCCGCCAGG + Exonic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900314613 1:2050598-2050620 GCGCAGCGCTGACGGCGGCGGGG + Exonic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900786924 1:4655221-4655243 CCGGCGCGCCGCCGCCGTTGGGG - Exonic
901022194 1:6261086-6261108 GCGCCGGGCGGCCGGGGGCGGGG + Intergenic
901055543 1:6447312-6447334 TCGCCGCGGCGCCCCCCGCGCGG + Intronic
902044275 1:13513557-13513579 GCGCCGCGGCGGCGCAGGCTGGG + Exonic
902375133 1:16026921-16026943 GCCCCGCCCCGCCGCCCCCGGGG - Intronic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902478842 1:16701325-16701347 TCGCCGCGGCGCCTCCCGCGCGG - Intergenic
902600919 1:17539774-17539796 GCGCCGCCCGCCCGCCCGCGAGG - Intergenic
903233935 1:21937497-21937519 GGGCCGGGCCGCGGCCCGCGCGG - Intergenic
903466426 1:23555069-23555091 GCGCCGCAGCGCCGCCGGTGGGG + Intergenic
903639402 1:24848321-24848343 CCTCCGCGCCTCCCCCGGCGGGG + Intergenic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
904181369 1:28668904-28668926 GGGCCGCGCGGCGGCCGGCGAGG + Intronic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904500206 1:30908798-30908820 CCGCCGGGCCGCCCCCAGCGCGG + Intergenic
905037915 1:34929599-34929621 GCGCCGAGCGGCAGCGGGCGCGG + Intergenic
905867112 1:41382390-41382412 GGGCCACGCCGCCGCCTTCGGGG + Exonic
905990785 1:42335283-42335305 GCGTCGCTGCGCCGCCGGCCCGG + Intronic
906320716 1:44813701-44813723 GCCCCGTGTCGCCGCCGGAGAGG + Exonic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906662541 1:47593269-47593291 GCGGCCCGCCGCCGCCAGCCCGG + Intergenic
907277800 1:53326766-53326788 CCGCCGCGCTGCCACCTGCGCGG - Intronic
910679087 1:89843982-89844004 GCGCTGCGGAGCCGCCTGCGAGG + Intronic
910936449 1:92486802-92486824 GCGCCGAGCCCCCGGCGGAGAGG + Intronic
912716966 1:111989874-111989896 GCGCGGCGCCGGCAGCGGCGGGG - Intergenic
913959459 1:143327601-143327623 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914053819 1:144153174-144153196 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914125327 1:144813191-144813213 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
914702933 1:150150342-150150364 CCGCCGCGGCGCCGACGGAGCGG - Intronic
916179145 1:162069540-162069562 GCGTCGCGCGGCCGGGGGCGCGG + Intergenic
918260284 1:182789665-182789687 GTTCTGCGCCGCCGCCCGCGAGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
921089658 1:211830678-211830700 GGGCCGCGCCACAGCCGGAGCGG - Exonic
922518268 1:226223920-226223942 GCGCTGCGACGCCGACGGGGCGG - Exonic
923007918 1:230067081-230067103 GCCGCGCGGCGCCGCCGGCCCGG + Intronic
923372658 1:233328342-233328364 GCCCCGCGCCGCCGCCCTCGCGG + Exonic
923461765 1:234214706-234214728 GCAGAGCGCCGCCGCCTGCGTGG + Intronic
1062759937 10:10733-10755 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062759944 10:10762-10784 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1063443069 10:6089141-6089163 GCTCCGCTCTGCCGCCGGCGCGG + Intronic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209110 10:13348201-13348223 CCGCCGCGCTCCCGCCGGCTGGG + Exonic
1070290662 10:75111506-75111528 GCTCCGAGCAGCTGCCGGCGCGG + Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1070923812 10:80205269-80205291 GCACCGCGGCGCCGCGGGTGAGG - Intronic
1071690871 10:87818286-87818308 GCGACCCGCGGTCGCCGGCGCGG + Intronic
1071997554 10:91162972-91162994 CCGCCCCGCCCCCGCCGGCGCGG + Intergenic
1071997736 10:91163562-91163584 GGGGCGCGCGGCTGCCGGCGGGG - Intronic
1072169985 10:92849099-92849121 GCGCCGGGCTGCCGCGGGCGTGG + Intronic
1072784048 10:98268370-98268392 GCGCCCAGCCGCAGCCGGCGGGG + Intergenic
1072930674 10:99659478-99659500 ACGTGGCGCCGCCGCCGGCCGGG + Intergenic
1073577507 10:104638999-104639021 GCGCCGGGCCTCCTCCGGCAGGG + Intergenic
1075031947 10:119029758-119029780 CCGCCTCCCCGCCGCCGGCGCGG - Exonic
1075054316 10:119206859-119206881 GCCGCGCACCGCGGCCGGCGGGG + Intergenic
1075492089 10:122880014-122880036 GCGCCGGGCCGCCGGCGACCGGG + Intergenic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076817064 10:132920257-132920279 GCCCTGCGCCGGCGCCGGGGTGG + Intronic
1076949748 10:133670938-133670960 GTGCAGCGCGGCCCCCGGCGGGG + Intronic
1076950732 10:133674237-133674259 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076951722 10:133677547-133677569 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076952711 10:133680857-133680879 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076953695 10:133684156-133684178 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076955668 10:133743818-133743840 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076956658 10:133747128-133747150 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076957645 10:133750437-133750459 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076959619 10:133757046-133757068 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076960603 10:133760345-133760367 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080283600 11:30585391-30585413 GCGCCCCGCGGCCGCCCCCGGGG - Intronic
1080418652 11:32091649-32091671 CCGCCGCGCCCCGGCCGGGGTGG + Intronic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1082928992 11:58579510-58579532 GGGCTGCTCCTCCGCCGGCGGGG - Exonic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083048241 11:59755348-59755370 GCGCTGCGCCGGCGCCGGCCCGG + Exonic
1083335121 11:61917604-61917626 GCCCCGCCCCTCCGCCGGCCCGG + Intronic
1083572768 11:63768986-63769008 GGCCCGCACCGCCGCCTGCGGGG + Intergenic
1083999583 11:66288915-66288937 GGGGCGCGGCGCGGCCGGCGGGG - Intronic
1084028396 11:66466922-66466944 GCGCGGAGCCGCCGCGGGCCGGG + Exonic
1084070075 11:66728179-66728201 CCGCCGCGCCCCCGCCCGCCCGG - Intronic
1084204641 11:67584456-67584478 GGGCCGCGCAGCGGCCTGCGGGG - Exonic
1084410973 11:69005733-69005755 GGGCCGCGGGGCCCCCGGCGCGG - Exonic
1085123603 11:73982847-73982869 GCTCCGCGCAGGCGGCGGCGCGG + Exonic
1085123604 11:73982850-73982872 AAGCCGCGCCGCCGCCTGCGCGG - Exonic
1085396161 11:76208188-76208210 GCACCGCGACGCCACCTGCGTGG + Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087252923 11:95923898-95923920 CGGCCGAGCCGCCGCCGGCTGGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089533789 11:119148980-119149002 GCGCCGCCCGGCAGCCCGCGGGG - Intergenic
1089567855 11:119381534-119381556 GCGCCGCGCCAGCGCCAGCCGGG - Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091303619 11:134523507-134523529 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303628 11:134523538-134523560 GCGCCTCCCCGCGGCCGGCCTGG - Intergenic
1091303648 11:134523600-134523622 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303668 11:134523662-134523684 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303679 11:134523693-134523715 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303700 11:134523755-134523777 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303719 11:134523817-134523839 GCGCCTCCCCGCGGCCGGCCTGG - Intergenic
1091303730 11:134523848-134523870 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303750 11:134523910-134523932 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303811 11:134524096-134524118 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303831 11:134524158-134524180 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303853 11:134524220-134524242 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303864 11:134524251-134524273 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091616085 12:2052569-2052591 GGGGCGCGACGCCGCCGGCGGGG + Intronic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1092462341 12:8697843-8697865 GCGCCGCGGCGCGGCGGGCGGGG - Intronic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1096783876 12:54006222-54006244 GCCCCGCGCCTCGGCCGGCCCGG + Intronic
1097192188 12:57224928-57224950 GCGCCCCGCCGCGGCCGGAGCGG + Exonic
1097891387 12:64780865-64780887 TCGCCTCGCCACCGCCGCCGCGG - Intergenic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1098963679 12:76764145-76764167 GGCCCGCGTCGCCTCCGGCGGGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1100469033 12:94873772-94873794 CCGCCCCGCCCCCGCCGGCTTGG - Intergenic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101493949 12:105236119-105236141 GCGCGGGGCCGCCGCGGGCACGG - Intronic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256426 12:111418195-111418217 CCGCGGGGCCGCCGCCGGGGAGG - Exonic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102887510 12:116533328-116533350 TCGCCCCGCCCCCTCCGGCGTGG + Intergenic
1102961965 12:117099043-117099065 GCTCCTCGCCGCAGCCCGCGAGG + Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103764540 12:123271301-123271323 GCGATCCGCAGCCGCCGGCGCGG + Intronic
1104021177 12:124993583-124993605 GCCGCGCCCCGCCCCCGGCGCGG - Intergenic
1104376287 12:128267425-128267447 GCACAGCGGCGCCGCCGGCCCGG - Exonic
1104929197 12:132329357-132329379 GCGCCGGGCCACGGCCGCCGGGG + Intergenic
1105411818 13:20177384-20177406 GCGCCGCGCCGCCTCCCGCAGGG + Intergenic
1105578021 13:21670967-21670989 GCGCCGCTCTGCGGCAGGCGAGG - Intergenic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106517119 13:30465265-30465287 GCGGGGCGCCGCGGCGGGCGAGG - Intronic
1108690019 13:52851297-52851319 TCCCGGCGCCGCCGCCGTCGTGG - Intergenic
1112450291 13:99501688-99501710 GCGCCGCTCCGGCGCGGGCCAGG - Exonic
1113779720 13:112969172-112969194 GCGCTGCGCCGCGGGGGGCGGGG - Intronic
1113906553 13:113822019-113822041 GCGCCGCGCAGCTGCAGGAGAGG - Exonic
1113985733 13:114314429-114314451 GCGCCGCGCGCCCTCCCGCGCGG - Intergenic
1115754208 14:36517376-36517398 GCGCCGCGGGGCTGGCGGCGTGG + Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116452835 14:45083974-45083996 GCCCCGCCCCGCCGCGAGCGAGG - Intergenic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116849445 14:49893421-49893443 GCGCCGCGCGAGCGCCGCCGCGG - Exonic
1117377405 14:55129176-55129198 GCGCCGCCCCGCCTCGGGAGAGG + Exonic
1117875746 14:60249116-60249138 GCGCCGCGCCGCAGCTGTAGCGG + Intronic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1121050439 14:90816332-90816354 GCGCCGCGGCGGCGGCGGTGGGG - Exonic
1121137170 14:91509785-91509807 GGGCCGCGCCGCCGCCTGCATGG + Exonic
1121690894 14:95876570-95876592 GCGCCCCGCCGCTGCGGTCGCGG + Intergenic
1122275085 14:100587099-100587121 GCGCTGCGCCCCCGCCGTGGAGG - Intronic
1122470903 14:101965132-101965154 GCGCCGCGCCGGCCTCTGCGGGG - Intronic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122904582 14:104795832-104795854 CCACCGCGCGGCCGGCGGCGAGG + Intergenic
1123002034 14:105300910-105300932 GCGGCGCGCCGGCGTCGGAGGGG + Exonic
1123024043 14:105415230-105415252 GCCCCGCGCCCCCGCCCGCGCGG - Intronic
1123047618 14:105526544-105526566 GCGCCCCTCCCCCGCCCGCGCGG - Intergenic
1124652325 15:31483266-31483288 GCGGCGCGGCGCGGGCGGCGAGG - Exonic
1125051174 15:35299488-35299510 GCTCCGCGCTGCCGCCACCGCGG - Intronic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1125522908 15:40358139-40358161 GCGCGGCGCCGCTGCCGGAGCGG - Intergenic
1125594233 15:40874063-40874085 GCGCTACGCCGCCGCGGGGGAGG + Exonic
1126736563 15:51737288-51737310 GAGCCGCACCGCCTCCTGCGCGG + Intronic
1127789891 15:62390444-62390466 GCGCGGCGCCGCGGCCGGACCGG + Intergenic
1127877188 15:63121809-63121831 GCCCCGCGCCGCGGCTGGCAGGG + Exonic
1128161037 15:65422956-65422978 GAGGCGCGGCGCCGCGGGCGGGG + Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1129162194 15:73753087-73753109 GCGCCGGGTCGCCGCCGGTGGGG + Intergenic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1130115406 15:81001345-81001367 GCGCCGGGCCGCCGGGCGCGCGG + Exonic
1130283896 15:82540192-82540214 GCGCCGAGCCCCGGCCGGTGTGG + Intronic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130564542 15:84982144-84982166 CCGCGGCGCCGCCGCCAGCATGG + Exonic
1131094785 15:89648380-89648402 GCCCGGCGCCGCCGCCCGCAAGG - Exonic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132754274 16:1475037-1475059 GCGTCACGTGGCCGCCGGCGCGG - Exonic
1132779367 16:1614360-1614382 GCGCCCTCCCGCCGCCGGCCCGG + Intronic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1134134085 16:11668421-11668443 GCCCCGCGCTGCGGCGGGCGGGG - Exonic
1135047775 16:19168705-19168727 GTGCCGCGCCCCCTCCGGCTGGG + Intronic
1135517670 16:23149156-23149178 CCGCGCCGCCGCCGCCAGCGCGG + Exonic
1137614546 16:49838862-49838884 GCGCTGGGCCGCCCCCCGCGCGG - Intronic
1137655121 16:50153125-50153147 GCGCCGCGCAGCAGCCCGGGAGG - Intronic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1140442775 16:74999739-74999761 GCGCCGTGCCGCCGCCGGGAGGG + Exonic
1141054528 16:80803719-80803741 GGGGCGCGCCGCGGCCGGCGGGG - Intronic
1141989676 16:87602753-87602775 GCGCCGCGCCGAGGCCGGGCGGG - Intronic
1142393243 16:89816319-89816341 GCCCCCAGCCGCCGCCCGCGGGG - Intronic
1142474601 17:181487-181509 GCGCCGCCCCGCCCCGGGCGCGG + Exonic
1144756483 17:17682840-17682862 CCGCCGCGCCCCCGCCAGCCCGG - Intronic
1146183004 17:30709249-30709271 GCGCCGCTCCGGGGCCCGCGCGG - Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148826460 17:50397617-50397639 GCACGTCGCCGCCGCCGGAGGGG + Intergenic
1149430653 17:56593886-56593908 GCCCTGCGCCGCCGCCGGCCCGG + Exonic
1149430731 17:56594144-56594166 GCGCGGCGGCGCCGCGGGCTCGG + Exonic
1149660665 17:58332602-58332624 GCGCCCCGCCCCCGCCCGCAGGG + Intergenic
1150675889 17:67245525-67245547 GCGCCGCGCCGCGGGCGGCAAGG - Intronic
1150764625 17:67993545-67993567 GCGCGGCGGCGGCGCGGGCGCGG + Intronic
1151370735 17:73644875-73644897 CCGCCGCCCCGCGGCTGGCGCGG - Intergenic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152222142 17:79074804-79074826 CCGCCGCGCGGCCGCTGGCCGGG + Intergenic
1152758925 17:82098356-82098378 CCGGCGCGCCGCCGCCGGTGGGG + Intergenic
1152952808 18:10929-10951 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952815 18:10958-10980 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952822 18:10987-11009 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952829 18:11016-11038 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952836 18:11045-11067 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154174506 18:12076629-12076651 GAGCCGCCCGGACGCCGGCGGGG - Intergenic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1155054150 18:22170365-22170387 GCGCCGCGGGGACGCCGGTGGGG + Intronic
1157464239 18:47930614-47930636 GAGCCTGGCCGCCGCCCGCGGGG + Intronic
1157849043 18:51030460-51030482 GCGCCGCGCCGCTGCCCGCGCGG - Exonic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158137731 18:54224623-54224645 GCGCCGCGCTGCGGGCGGGGCGG - Exonic
1158602114 18:58864070-58864092 GTGCCCGGCCGGCGCCGGCGGGG - Intronic
1159040669 18:63320356-63320378 GCGCGGGGCCGCGGCCGGGGAGG + Intergenic
1159045554 18:63366574-63366596 GCGGCGCGCGGCCCCGGGCGGGG - Intronic
1160024933 18:75209233-75209255 GGGCTGCGCCGGCGCCGGGGAGG - Exonic
1160863899 19:1249009-1249031 GCGCCGCGCTGCCCCTGGCAGGG - Intronic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161006734 19:1940967-1940989 CCGCCGGGCCGCTGCCCGCGGGG - Intergenic
1161031896 19:2061444-2061466 GCGCGCGGCCGCCGCCGGGGAGG - Intergenic
1161233235 19:3186008-3186030 GCGCGGCCCCGCCGCCGGCCAGG + Exonic
1161384884 19:3985591-3985613 GCGCCGCGCCGGCGCCGAATGGG - Intergenic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162975793 19:14206519-14206541 GCGCCGCTCCGGGGCCCGCGCGG + Intergenic
1163529765 19:17842492-17842514 GCGCCGCGTGGCCGCCTGCCAGG - Exonic
1163617861 19:18340487-18340509 GCGCCCCGCCCCCGTCGGCTAGG - Intergenic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165495822 19:36151601-36151623 GCGCCGAGCCGGGGCAGGCGGGG - Intronic
1166104597 19:40591032-40591054 GCGCCGGGCCTCAGCCTGCGGGG - Exonic
1166106687 19:40601240-40601262 CCCCCGCGCGGCCGCCGGGGAGG + Intronic
1166366407 19:42280630-42280652 GCGCCCCGCCGCGGCCCGCGTGG + Intronic
1167309538 19:48729068-48729090 GCGCGCCGCAGCCGCCGGCTCGG - Exonic
1167833720 19:52048872-52048894 GCGGCGAGGCGACGCCGGCGCGG - Intronic
1202693295 1_KI270712v1_random:105832-105854 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
1202712861 1_KI270714v1_random:27156-27178 TCGCCGCGGCGCCTCCCGCGCGG - Intergenic
925419987 2:3703862-3703884 GCGCCGCGCGGCCACCTTCGAGG + Exonic
927544499 2:23940661-23940683 GGGCCGCGCCGCGTCCGGCGGGG + Intronic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
929468639 2:42169385-42169407 GCGCCGCTCAGCCGCCTGCCCGG - Exonic
929501320 2:42493736-42493758 GCTCAGCGCTGGCGCCGGCGAGG - Exonic
929808519 2:45169397-45169419 GCGCCCGGCCGCCGCAGGAGCGG - Intergenic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
933953273 2:87348727-87348749 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934067215 2:88351058-88351080 GCGCCACGGCGGCGCCGGCTGGG + Intergenic
934237504 2:90245072-90245094 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
936569406 2:113602189-113602211 TCTCTGCGCCGGCGCCGGCGCGG + Intergenic
936569834 2:113603718-113603740 GCGGCGCGCCGGCGGAGGCGCGG + Intergenic
938496796 2:131801993-131802015 GCTTCGCGCTGCCGCCGGCTGGG - Intergenic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940037980 2:149330296-149330318 GCGCCGCGCTCCCGCCCGCAGGG - Intronic
942240822 2:173963760-173963782 GGCCCCCGCCGCCGCCGGAGCGG - Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
944811186 2:203328669-203328691 GAGGCGCGCGGCCCCCGGCGGGG - Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
947119444 2:226799912-226799934 GCGCTGCGCCGGGGTCGGCGCGG - Intergenic
947669139 2:231925783-231925805 GCCCCACGCGCCCGCCGGCGCGG + Intronic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948824653 2:240568411-240568433 GCTCCGCTCGGCCGCCGCCGGGG - Intronic
1172015428 20:31870257-31870279 GCGCCGGGCCGCGGCGGCCGGGG + Intronic
1172239266 20:33401403-33401425 GAGCAGCGCGGCCGCCGGGGTGG - Intronic
1174380716 20:50153740-50153762 GCGCGGCGGCGGCGCGGGCGGGG + Intergenic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1174607036 20:51768456-51768478 GCGCCGCGCCGCCCCGGGGGAGG + Exonic
1175521429 20:59604791-59604813 GCGCCTGGCTGCAGCCGGCGAGG + Exonic
1176131726 20:63499184-63499206 GCGCCCCGCCCCCTCCCGCGCGG - Exonic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1178513834 21:33229902-33229924 CCCCCGCGCCGGCGGCGGCGCGG + Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180871790 22:19150563-19150585 CCGCCTCGCCGCCGCCCGCGGGG + Intergenic
1180983727 22:19891945-19891967 GCGCCTGGCCGCAGCTGGCGAGG - Intronic
1181094441 22:20495888-20495910 GCGCCGCGCAGGCGCCGGGCGGG + Intergenic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1181478117 22:23180895-23180917 GCGCCGCGCCGCCGCTGAGACGG + Exonic
1181745705 22:24953581-24953603 GGGCCGCGCCGCCATCGGGGCGG - Intronic
1183328531 22:37207195-37207217 TCGCCAGGCCGCCGCCGGCTCGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1184086834 22:42270466-42270488 GGCCCGCCCCGCCGCCGGCCCGG - Intronic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185388935 22:50548658-50548680 GCGCCCCGCTGCGGCCGGCAGGG - Exonic
1185395010 22:50582436-50582458 GCCCCGCCCCGCCCCAGGCGCGG + Intronic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950729860 3:14947839-14947861 GCGGCGGGCGGCCCCCGGCGCGG - Intronic
952867235 3:37862132-37862154 GCGCCGCGCCCCCGCGCGCTTGG + Intronic
953598342 3:44338525-44338547 GCGCCCTGCCGCCGCCGGAGCGG + Exonic
954838928 3:53494622-53494644 GCGGCGCGGCGCGGCGGGCGCGG + Intergenic
956761304 3:72447214-72447236 GCGCCCCGCCTCCGCCCTCGCGG - Intergenic
961081916 3:124034237-124034259 GCCCCGGGCCCCCGACGGCGAGG - Intergenic
961739986 3:129027247-129027269 GAGCACCGCCGCCGCCCGCGGGG - Intronic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966390912 3:179451503-179451525 GCGGCGCGCCGGAGCCGGGGCGG + Exonic
966594203 3:181711784-181711806 CCCCCGCGCGGCCGGCGGCGCGG + Intergenic
966849429 3:184155553-184155575 GCCGCGCGCCGCCGCCGTCTGGG + Exonic
966886465 3:184380208-184380230 CCGCCGCACCGCCCCCGGCCCGG + Exonic
966982657 3:185152788-185152810 ACCCCGCTCCGACGCCGGCGAGG + Exonic
967859595 3:194141282-194141304 CCGCCGCGCGCCCGCCGGGGCGG + Intergenic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
967904102 3:194486795-194486817 GCACGCCGCCGCCGCGGGCGCGG - Intronic
968225542 3:196969876-196969898 GCGTCGCGCCGCAGCTCGCGGGG - Intergenic
968230638 3:197003009-197003031 GCCCCGCGCCCCCGTCCGCGAGG - Exonic
968556593 4:1248995-1249017 GCGCTGCGCCGCCGCGAGCCCGG + Exonic
968642310 4:1720931-1720953 CCGCCGCCCGGCCGCCCGCGGGG + Exonic
968642324 4:1720973-1720995 CCGCCGCCCGGCCGCCCGCGGGG + Exonic
968642338 4:1721015-1721037 CCGCCGCCCGGCCGCCCGCGGGG + Exonic
968642352 4:1721057-1721079 CCGCCGCCCGGCCGCCCGCGGGG + Exonic
968701423 4:2059768-2059790 GCGGCGCGCCGCCTCCTGCTCGG - Exonic
968775201 4:2536237-2536259 AGGCCGCGCCGCCGCCCGCGAGG - Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
968850486 4:3074612-3074634 TGGCCCCGCCTCCGCCGGCGCGG + Intergenic
968850487 4:3074615-3074637 GGGCCGCGCCGGCGGAGGCGGGG - Intergenic
969346764 4:6575129-6575151 GGGCCGCGTCCCCGCCCGCGCGG + Intergenic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
972686841 4:41360548-41360570 GGGCCGCTCCGCCCCCGGGGAGG - Intronic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975373935 4:73620459-73620481 GCGCCGCCCCTGCGCCCGCGCGG - Exonic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983238722 4:165207752-165207774 GCGCGGCGCCCCCTCCGGGGCGG + Intronic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
985452218 4:190068423-190068445 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985453202 4:190071720-190071742 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985454192 4:190075013-190075035 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985455180 4:190078306-190078328 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985456168 4:190081606-190081628 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985457152 4:190084900-190084922 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985458139 4:190088193-190088215 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985459128 4:190091493-190091515 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985463381 4:190174262-190174284 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985555304 5:555199-555221 GCACCGCCCCGGCGCCCGCGAGG - Intergenic
987374011 5:17217831-17217853 GCCCCGCGCCGCCGCGGACCCGG + Intronic
991298200 5:65103117-65103139 GCGCCCCGACGCTGCCGGCGCGG + Intergenic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
992105504 5:73447160-73447182 TGGCGGCGCCGCCACCGGCGAGG + Exonic
992400146 5:76403919-76403941 GCTCCGGGTCGCCGCCGGCTTGG + Intronic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997984485 5:138492024-138492046 GAGCCTCGCAGCCGCGGGCGGGG - Intergenic
997990801 5:138543130-138543152 CCGCGGAGCCGCCGCCGGGGAGG - Exonic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
999696291 5:154190821-154190843 GCGGCGCGGCGGGGCCGGCGGGG + Exonic
1001381981 5:171311324-171311346 GCACCGCGGGGCCGCCGGCGGGG - Intronic
1001529893 5:172454418-172454440 GGGGCGCGCCGCCGCGGGCAGGG + Exonic
1002061986 5:176630546-176630568 GGGCGGCGCGGCCGCCAGCGGGG - Intronic
1002190063 5:177473342-177473364 CCGCCGCCCCGCCGCCGGGAAGG - Intronic
1002291848 5:178205369-178205391 GGGCCGCGCCGGCGGCTGCGTGG + Intronic
1002527065 5:179820793-179820815 GCGCCGCGACGACGGTGGCGGGG + Exonic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1002901877 6:1416518-1416540 GCACCGGGGCGCCGCCTGCGGGG + Intergenic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1003942606 6:11044130-11044152 GGGCCGAGCGGGCGCCGGCGCGG - Intronic
1004241329 6:13925002-13925024 GCCCTGGGCCGCCGCCGGCCAGG + Exonic
1005928971 6:30466617-30466639 CCGCCGCGGCGCCGACAGCGAGG + Intergenic
1006369162 6:33633683-33633705 ACGACGCGCCGCCGCCGCCAAGG - Intronic
1006665086 6:35688265-35688287 GCGCCGGGACGCCGCGGGCGCGG - Intronic
1006706757 6:36027518-36027540 GCGCCTCACCGTGGCCGGCGGGG - Intergenic
1007558108 6:42783149-42783171 GCGCGCCGCCGCCGCGGGCTCGG - Intronic
1007631702 6:43276467-43276489 GCGCGGCGCCGCCACGGGGGTGG + Intronic
1007924808 6:45642520-45642542 GGCCCGGGCCGCCGCCCGCGTGG + Intronic
1011128735 6:84033707-84033729 GCCCCGCGCCGCCTCCGCTGCGG + Intergenic
1011640192 6:89411343-89411365 GCCCCGCGTCGCCGCGGGAGGGG - Intronic
1011734214 6:90296254-90296276 GCGCGGCGCGGCCGCCGGCTCGG + Intronic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013793674 6:113860399-113860421 GGCCAGCGCCGCCGCCTGCGAGG + Exonic
1014798314 6:125749653-125749675 GCGCGGCTCCGGCGGCGGCGCGG - Exonic
1015149248 6:130019929-130019951 GCGCCGCGCCGGCCCGGGTGCGG + Intronic
1015625977 6:135181407-135181429 GCGCCGCTGCGCAGCCGGGGAGG + Exonic
1015910241 6:138162051-138162073 GCGCCGGGCCGCCGCCCACAGGG - Exonic
1015994923 6:138987877-138987899 TCGCCGCGCCGCTGCCTGCGAGG + Exonic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1019233010 6:170584522-170584544 TCGCCGAGTCGGCGCCGGCGTGG - Exonic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019828285 7:3301485-3301507 GCGCCGCGCCTCCCGCGGAGTGG + Exonic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1021313185 7:19117171-19117193 GCGCAGCGCGGGCGGCGGCGCGG - Exonic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1022363357 7:29685001-29685023 CCGCCGCGGCGCCGCCGGGCTGG + Intergenic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1024472140 7:49775344-49775366 GGGGCGCGCCGCCGCCAGCCGGG - Exonic
1026765018 7:73154959-73154981 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1026840413 7:73667720-73667742 GCGGCGCGGCGCGGCCGGGGCGG + Intergenic
1027041490 7:74964714-74964736 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027082152 7:75237655-75237677 GCGGCGCGCGGCGCCCGGCGCGG + Intergenic
1028621432 7:92833340-92833362 CCGCCGCGGCGCCGCTGGGGCGG + Exonic
1029123113 7:98281505-98281527 GTGCAGAGGCGCCGCCGGCGGGG + Intronic
1029390725 7:100272174-100272196 GCGGCGCGCGGGTGCCGGCGCGG + Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032791533 7:135246473-135246495 GGGCAGCGCCGCCTCCTGCGGGG - Exonic
1033361253 7:140640506-140640528 CCGCGGAGCCGCCGCCCGCGGGG - Exonic
1034219267 7:149431681-149431703 GCGCCCCGCCCCCGCCCGCTGGG + Exonic
1034649224 7:152676192-152676214 GCGCCAGGCCGCGGCCGGGGAGG + Intergenic
1035023067 7:155809978-155810000 TCTCCGCGCCCCCGCCGCCGGGG + Intronic
1035153392 7:156893196-156893218 GCGCCGCGCAGTCGGGGGCGGGG + Exonic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1036454179 8:8893361-8893383 GCGCCGCGCGGCGGGCGGAGAGG - Exonic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1036789478 8:11708611-11708633 GCGCGGCGACACCGGCGGCGGGG - Exonic
1037807530 8:22066896-22066918 GCGCGGCGCCGCCCCGGGCCGGG + Intronic
1037815450 8:22109477-22109499 GCGCGGCGCCGCGGCCTGCCCGG + Intergenic
1037876561 8:22551643-22551665 GCGCCGCCTCCCCGCCGGCCAGG + Intronic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1039493589 8:37965338-37965360 GCCCTGCGCCGCCGCCCGCCCGG - Exonic
1039595599 8:38787648-38787670 ACGCGGCGGGGCCGCCGGCGAGG + Exonic
1040039142 8:42897914-42897936 TCGCCGCGGCGCGGCCGGGGAGG + Intronic
1041304634 8:56446746-56446768 GCCCCGCGCCGACGCCTTCGCGG + Intergenic
1041689882 8:60678639-60678661 GCGGCGCGCGGGCGCGGGCGCGG + Intergenic
1041690083 8:60679352-60679374 CCGCCGGGCCGGCGGCGGCGGGG + Intronic
1042962630 8:74320626-74320648 GCGCAGCGCTGGCGCCGGCCAGG + Intronic
1043502855 8:80873970-80873992 GCGCCGCGCTGCAGCCTGCCGGG - Intronic
1043954192 8:86342591-86342613 GCGCGGTGCCGGGGCCGGCGGGG + Intergenic
1044335976 8:90985232-90985254 GCCCCCCGCCGCCGCCACCGCGG - Exonic
1047292286 8:123541109-123541131 CCGCCCCGCCGCCCCCGTCGCGG - Exonic
1048550297 8:135427540-135427562 GCGCCTCTCAGCCGCCGGCATGG + Intergenic
1049405268 8:142449580-142449602 GCGCCGCCCCGCCCCCGGCTCGG + Exonic
1049684590 8:143934226-143934248 TCCCCGCCCCGCCCCCGGCGGGG - Intronic
1049693657 8:143973469-143973491 GCGCCCCGCGCCCGCCGGCATGG - Intronic
1049721078 8:144115861-144115883 GCGCGGGGCCTGCGCCGGCGGGG + Intronic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050455802 9:5832935-5832957 CGGCCGCGCCACCGCCGGAGAGG - Exonic
1053306217 9:36986353-36986375 CCGCCGCGGCCGCGCCGGCGGGG + Intronic
1053600503 9:39604222-39604244 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1053835345 9:42129340-42129362 GCGCGGCGCCGCCCCAGGCACGG + Exonic
1053858151 9:42358078-42358100 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1054091014 9:60847303-60847325 GCGCGGCGCCGCCCCAGGCACGG + Intergenic
1054112425 9:61122859-61122881 GCGCGGCGCCGCCCCAGGCACGG + Intergenic
1054253026 9:62738162-62738184 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1054567142 9:66772661-66772683 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1054595280 9:67059270-67059292 GCGCGGCGCCGCCCCAGGCACGG - Intergenic
1054820451 9:69516208-69516230 CCGCCTCGCCGCCGCCCGCGGGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1059483634 9:114611309-114611331 GCTCCGCTCCGCCGCGGGCCCGG + Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060812687 9:126618955-126618977 ACGCCGCGGCCCCGCCGCCGAGG - Intronic
1060973939 9:127754225-127754247 GCTGCGCTCCGCCGCCGGCGGGG + Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061365905 9:130172430-130172452 GCTGGGCGCCGGCGCCGGCGCGG - Intergenic
1061559735 9:131394511-131394533 GCGCCGCGCGGCCTCAGGCTCGG + Intronic
1061666102 9:132161856-132161878 GCGCCGGGCAGCCCCCGGCCCGG - Intronic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062022560 9:134326356-134326378 GCGGCGCTGCGGCGCCGGCGGGG - Intronic
1062294779 9:135818663-135818685 GCGCCGCGGCGCAGGCGTCGTGG - Intronic
1062314821 9:135961443-135961465 GCGCCTCGCTCCCGCCGCCGGGG + Intergenic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062537847 9:137028623-137028645 GCGCCGAGCGGACGCTGGCGAGG + Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1062596269 9:137301313-137301335 GCGCCCCGCCCCCACCCGCGAGG + Exonic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185469415 X:373714-373736 GGGCCGGGCCGGGGCCGGCGGGG + Intronic
1185469416 X:373717-373739 GCGCCCCGCCGGCCCCGGCCCGG - Intronic
1187281394 X:17860827-17860849 GCGCCGCGCACTGGCCGGCGGGG - Intronic
1187900943 X:24025861-24025883 CCCCCGCGGCGCCGCCGTCGGGG + Intronic
1189308838 X:40006271-40006293 GCTCCGCGCCGCTGGCGGAGTGG + Intergenic
1189331252 X:40146229-40146251 GCTCCGCGCCTCCGCGGGAGCGG - Intronic
1189474021 X:41334992-41335014 GCCCTGCGCCGCAGCCGGGGAGG + Intronic
1192260774 X:69504886-69504908 GAGCCGGGCGGCCGCCGGCGCGG + Intergenic
1199500373 X:148500687-148500709 GCGCGGCGCGGCAGCCGGGGCGG - Exonic
1199699107 X:150363468-150363490 GGGGCGGGCGGCCGCCGGCGCGG - Exonic
1200003192 X:153072525-153072547 GCGCCGCTGCGGCGGCGGCGGGG - Exonic
1200004531 X:153077484-153077506 GCGCCGCTGCGGCGGCGGCGGGG + Intergenic
1200126814 X:153819104-153819126 GCGCCGCGACGGCGGCGGGGTGG + Intronic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200209738 X:154341947-154341969 GCGCCGCGCCACACCCGGCAGGG + Intergenic
1200221114 X:154390145-154390167 GCGCCGCGCCACACCCGGCAGGG - Intronic
1200229513 X:154437072-154437094 GCGCCCCGCCGCAACCGGCAGGG - Exonic
1200240544 X:154490789-154490811 GTGACGCGCCGGCGCGGGCGCGG + Intergenic