ID: 1178514694

View in Genome Browser
Species Human (GRCh38)
Location 21:33236627-33236649
Sequence CAGTAGCAGCAGCAGTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178514686_1178514694 25 Left 1178514686 21:33236579-33236601 CCAGGAGGGCTTCAGCGGAATGT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG 0: 1
1: 0
2: 2
3: 29
4: 280
1178514689_1178514694 -2 Left 1178514689 21:33236606-33236628 CCAGTTGATGCCCCATGCCAACA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG 0: 1
1: 0
2: 2
3: 29
4: 280
1178514688_1178514694 -1 Left 1178514688 21:33236605-33236627 CCCAGTTGATGCCCCATGCCAAC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG 0: 1
1: 0
2: 2
3: 29
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178514694 Original CRISPR CAGTAGCAGCAGCAGTTGTT AGG Intronic
902489361 1:16769808-16769830 CAGCAGGAGCAGCAGCTTTTGGG - Intronic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
904174539 1:28617267-28617289 CAAAAGTAGCAGCAGTTATTGGG + Intronic
906345211 1:45010570-45010592 CAGCGGCAGCAGCAGCTCTTTGG - Exonic
906573109 1:46861966-46861988 CAACAGCAGCAGCAGCTGTTGGG - Intergenic
907388321 1:54140016-54140038 CAGTGGCAGCGGATGTTGTTGGG + Exonic
911084730 1:93966838-93966860 CATTAGCAGCAGAAGCTGATGGG - Intergenic
911779968 1:101864102-101864124 CAGTAACAACTGAAGTTGTTAGG - Intronic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912634248 1:111277164-111277186 CAGTGGCAGAAGCAGATGTGAGG - Intergenic
912721541 1:112024600-112024622 CAGCAGCAGCAGCAGCTAATGGG - Intergenic
912810418 1:112789988-112790010 CACTAACAGCAGTAGTTGCTGGG - Intergenic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
913350615 1:117854676-117854698 TAGTAGAGGCAGCAGTTGTGAGG + Intergenic
914874618 1:151503606-151503628 AAGTAGAATCAGCTGTTGTTTGG + Intergenic
916028450 1:160855694-160855716 CAGTAGCAACAGCAGTGGCAGGG - Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
919059212 1:192609220-192609242 CAGTAGCAGCAGATGGTGCTTGG - Intergenic
919338066 1:196265723-196265745 CAGTAGCAGAAGCATTTTTTGGG - Intronic
920866606 1:209758680-209758702 GAGAAGCAGCAGCAGCTGTGAGG + Exonic
922577406 1:226671406-226671428 CATTAGCAACAGCATTTATTGGG - Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923531077 1:234812717-234812739 CAGCAGGAGCAGCAGCTTTTGGG + Intergenic
1062954287 10:1529966-1529988 CAGTGGCAGGAGCAGTGGATGGG - Intronic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1063519195 10:6725562-6725584 CCATGGCAACAGCAGTTGTTGGG + Intergenic
1065543348 10:26793043-26793065 TAGTAGCAGTGGCAGTTGTGAGG - Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066000892 10:31103292-31103314 CAGTAGTAGCAGCAGATGCAAGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067712123 10:48657689-48657711 CATTAGCAGCAGCAGAAGGTAGG + Intergenic
1068856536 10:61803648-61803670 CATTATCAGCAGCAGATGCTTGG - Intergenic
1069727443 10:70590032-70590054 CAAGAGCAGCTGCTGTTGTTTGG - Intergenic
1069772422 10:70908107-70908129 CAGCAGTGGCAGCAGTTGGTCGG + Intergenic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1073067276 10:100770157-100770179 CATGAGCAGCAGCAGATGTAGGG - Intronic
1073100780 10:101005546-101005568 CTGCAGCTGCAGCAGCTGTTGGG - Exonic
1076634875 10:131875599-131875621 CAGAAGCAGCTGAAGGTGTTGGG - Intergenic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1082039911 11:47676343-47676365 GAGTAGCAGCAGTGGTTGTGGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1088182289 11:107126565-107126587 CAGCATCAGCATCACTTGTTAGG + Intergenic
1088923602 11:114279800-114279822 CAGTAGTGGCAGCAGTTTATAGG + Intronic
1089813676 11:121153039-121153061 GAGTAGCAGCCGCAGCTGTGGGG - Exonic
1091043325 11:132302751-132302773 CAGTTGCAGGAGCAGTGGATTGG + Intronic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095426969 12:42085751-42085773 CAGAGGCAGCAGCAGTCCTTCGG - Exonic
1096009894 12:48203977-48203999 CGGTAGCAGCAGCAACTGCTGGG - Intergenic
1097699648 12:62807044-62807066 CAGTAGCAACAGCAGGTGCAAGG + Intronic
1098404284 12:70107990-70108012 CAGTAGGGGCAGCAGTGGCTTGG + Intergenic
1099710147 12:86213298-86213320 AAAGAGCAGCAGCAGTTCTTGGG - Intronic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1104689230 12:130812598-130812620 CTTTAGCAGCAGTAGTTTTTTGG - Intronic
1105514454 13:21077232-21077254 GAGTGGGAGCAGCAGTTGTGGGG + Intergenic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108889999 13:55245206-55245228 CAGTAGCAGCCACAGGTCTTGGG + Intergenic
1109861538 13:68205914-68205936 CAGTAGCAGAGACATTTGTTTGG - Intergenic
1110819527 13:79898416-79898438 TAGTAGCAGCAGCAGTATCTTGG - Intergenic
1111833766 13:93361758-93361780 CAGGAACAGCAGTAGTGGTTAGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1117209255 14:53478476-53478498 CAGAAGCAACAGCCTTTGTTGGG + Intergenic
1117890852 14:60420428-60420450 CAGTGGCAGCAGCATGTGTTTGG + Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118266031 14:64295337-64295359 CAGTACCAGCCTCAGCTGTTTGG + Intronic
1118796174 14:69147374-69147396 CAGTAGCAACAGCATGGGTTAGG + Intronic
1119932862 14:78564977-78564999 CAGCAGCAGCAGCACTCATTTGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1121459696 14:94065469-94065491 CGGGAGCAGCATCAGTGGTTAGG - Intronic
1121850555 14:97218478-97218500 CATCACCAGCAGCAGGTGTTTGG - Intergenic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122295534 14:100703670-100703692 CAGTAGCAGGACCAGGTGTCGGG + Intergenic
1122564637 14:102643954-102643976 TAGTAACAGCAACAGTTGTTAGG - Intronic
1122930127 14:104929322-104929344 CAGAAGCTGCAGCAGCTGCTGGG + Exonic
1124239288 15:28016875-28016897 CAGTTGCAGAAGCAGTTCTCAGG - Intronic
1124338403 15:28874127-28874149 CGGTAGCTGCAGAAGTTCTTTGG + Intergenic
1124357035 15:29003331-29003353 CAGTAGCAGCAGATGTTCTTTGG - Intronic
1124373755 15:29117583-29117605 CAGTGGCAGAGGCAGCTGTTTGG - Exonic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1129564988 15:76612209-76612231 CAGCAGCAGCAGCAGCTTTTTGG - Intronic
1130235772 15:82132306-82132328 CATCAGCAACAGCAGTTGCTGGG + Intronic
1130634472 15:85604440-85604462 CAGCAGCAGCAGCTTTTGATTGG - Intronic
1130931626 15:88432515-88432537 CTGTAACATCAGCAGTGGTTAGG - Intergenic
1130989535 15:88868066-88868088 CAGCAGCAGCAACAGTTCTCAGG + Intronic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133828219 16:9297970-9297992 CTGTAGTTGCAGCAGGTGTTTGG + Intergenic
1135108394 16:19670896-19670918 CAGTAGTAGTAGCAGTAGCTGGG + Intronic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136459867 16:30403261-30403283 CAGCAGCAGCAGCAGCTTGTGGG - Intergenic
1137068958 16:35881930-35881952 CAGGGGCAACAGCAGTTGCTAGG - Intergenic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1138038345 16:53631768-53631790 TAGTAAAAGCAGCAGTTGTCAGG + Intronic
1138834155 16:60412925-60412947 CAGTGGCAGCAACAGTGCTTGGG + Intergenic
1139179518 16:64729457-64729479 CAGTTTCAGAAGCAGTAGTTTGG + Intergenic
1140834545 16:78781100-78781122 CAGAAACAACAGCATTTGTTTGG - Intronic
1145764902 17:27451893-27451915 CAGGAGCAGCAGCAACTGTATGG - Intergenic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1149086786 17:52727501-52727523 CAGTAGCAGCAAAAGTTCATTGG + Intergenic
1150445737 17:65225841-65225863 CAGTGGGAGCTGCAGGTGTTGGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151194003 17:72419096-72419118 CATTGGCAACTGCAGTTGTTGGG - Intergenic
1152821960 17:82441931-82441953 CAGCAACAGCAGCAGTTCTCAGG - Intronic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1155114588 18:22751972-22751994 CAGTGGCAGCAGCTGTTTATGGG - Intergenic
1155248026 18:23929180-23929202 CAGCAGCAGCAGCAGCTAGTTGG + Intronic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1157450338 18:47781802-47781824 CACTAGCAGCAGGAGCAGTTGGG - Intergenic
1157537609 18:48471564-48471586 CAGTTGCAGCACCAGTTGGAAGG - Intergenic
1157634380 18:49136004-49136026 CATGAGCATTAGCAGTTGTTTGG - Intronic
1157744355 18:50121759-50121781 CTGTGGCAGCTGCAGTGGTTGGG - Intronic
1158578585 18:58661523-58661545 AAGCAGCAGCAGCAGCTGGTAGG + Intergenic
1158585850 18:58733956-58733978 GAGTAGCCGAAGCAGATGTTTGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161208433 19:3054175-3054197 CAGCACCAGCAGCAGGTCTTGGG - Exonic
1165016295 19:32882671-32882693 CAGTGGCAGCATTAGTTCTTAGG - Intronic
1168384888 19:55954891-55954913 CAAGAGCAGCAGAAGTTGGTCGG - Exonic
925648907 2:6067862-6067884 CAGCAGAAGCAGCATTTTTTTGG + Intergenic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
926315652 2:11707751-11707773 CAGAAGCAGCAGCGCTTGGTTGG - Intronic
926415840 2:12649180-12649202 CAGCTGCAGGAGCAGGTGTTCGG + Intergenic
926829532 2:16946078-16946100 CATCAGCAGCAGCCCTTGTTCGG + Intergenic
926938034 2:18105646-18105668 CAGGAGCATCAGCAGTACTTGGG - Intronic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
928117658 2:28558824-28558846 CAGTGGCAGCTACAGTTGTGAGG + Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
930047574 2:47186647-47186669 CAGCAGCAGCAGCAAGTGTAAGG - Intergenic
930487683 2:52027743-52027765 CAGTAACTGCAGCTTTTGTTTGG + Intergenic
931904803 2:66830989-66831011 TATTAGCAGCAGCAGCTGCTGGG + Intergenic
932682242 2:73836319-73836341 CAGGAGCAGCAGCTGTTGCAGGG + Intronic
934715648 2:96541871-96541893 CAGCAGCAGCAGCAGCTATCAGG + Intronic
934910628 2:98251128-98251150 CAGTGGCAGCAGCTATTGTAGGG + Intronic
939441207 2:142252601-142252623 CAGCAGCAGCAGCATTTTATTGG + Intergenic
939792000 2:146589089-146589111 CAGCAGCAGAAGCAGATATTGGG + Intergenic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
941232357 2:162926603-162926625 CAGTGAGAGCACCAGTTGTTTGG + Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
942604701 2:177678452-177678474 CAGTAACCTCAGCAATTGTTTGG + Intronic
942712159 2:178848748-178848770 CAGAAGCAGCAGCAGCTCCTCGG + Intronic
943077714 2:183216697-183216719 CAGTTGAACCAGCAGTTGCTGGG - Intergenic
943492271 2:188569622-188569644 CAGCAGAAGCAGCAGATGCTGGG + Intronic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
948978921 2:241482733-241482755 CAGGAGGAGCAGCAGGTGTCCGG - Intronic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169878033 20:10318871-10318893 AAGTAGCAGGAGCTGTAGTTGGG + Intergenic
1172539973 20:35704704-35704726 CAATAGCTGCAGCAATTGATGGG + Exonic
1173229832 20:41185451-41185473 TAGCAGCAGGAGCAGTGGTTTGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174068498 20:47883236-47883258 CAGAAGGAGCAGCAGGTGCTGGG + Intergenic
1175646710 20:60680313-60680335 GAGTGGCGGCAGCAGTGGTTGGG - Intergenic
1176170348 20:63693767-63693789 CAGCAGCAGCATCACTTGTTGGG + Intronic
1177152492 21:17468959-17468981 CAAAAGCAGCAGAAGTTGGTGGG + Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1178963120 21:37086596-37086618 CATTAGAAGCAGCAGTCGATAGG + Intronic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1182438050 22:30343494-30343516 CAGTGGCAGTAGAAGCTGTTGGG - Intronic
1182652217 22:31861326-31861348 AAGCAGCAGCAGCAGTTGCAAGG - Intronic
1183784840 22:40023338-40023360 CAGCAGCAGCAGCTGGTGTTAGG - Intronic
1184159311 22:42688479-42688501 CAGGAGCTGGAACAGTTGTTGGG + Intergenic
1184250317 22:43256491-43256513 AAGTAGCAGCAGCAGGGGCTGGG + Intronic
1184781680 22:46652705-46652727 CAGCAGCAGCTGCAGATTTTCGG + Intronic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
951356276 3:21670843-21670865 ACGGAGCAGCATCAGTTGTTTGG - Intronic
951506798 3:23455920-23455942 CTGTAGCATGAACAGTTGTTTGG + Intronic
952784706 3:37141763-37141785 CAGTAGCATCAGACATTGTTTGG + Intronic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
955706193 3:61730213-61730235 CTGTAGCTGCAACAGTTGGTGGG - Intronic
956168698 3:66415870-66415892 CAGAAAAAGCAGCATTTGTTTGG - Intronic
956465617 3:69517990-69518012 CAGCAGCAGCAGCATCTCTTGGG - Intronic
958577202 3:95966191-95966213 CAGAAATAGCAGCAGATGTTTGG + Intergenic
959037896 3:101387008-101387030 TGCCAGCAGCAGCAGTTGTTAGG - Intronic
959362529 3:105411443-105411465 TAGTAGCAGCAGCAGCAGCTGGG + Intronic
960687151 3:120306549-120306571 CAGTAGAAGTTGCAGTGGTTCGG + Intergenic
960861133 3:122154472-122154494 CAGGAGTGGCAGCAGTAGTTTGG - Intergenic
961568639 3:127782715-127782737 CAGCAGCAGTAGAAGTTGGTGGG - Intronic
962186974 3:133270538-133270560 CAAAAGCAGCAGCAGGTGGTAGG - Intronic
963097268 3:141557167-141557189 CTGTAGCAGGAGTACTTGTTAGG + Intronic
963100846 3:141602464-141602486 CAGCAGGAGCAGCAGTGGGTGGG - Intronic
963642447 3:147877037-147877059 CAAAAGCAGCAGCATTTCTTAGG - Intergenic
964046837 3:152338547-152338569 CAGTGGTAGCAGCAGGTGTTGGG + Intronic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
964362041 3:155908499-155908521 CAGTAGAAGAGGAAGTTGTTAGG + Intronic
966461914 3:180185971-180185993 AATTGGCAGCAGCAGCTGTTGGG + Intergenic
967516645 3:190377292-190377314 CATTAGCAGCAGCATTTGCTTGG - Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
974321034 4:60350175-60350197 CAGTCTGAGCAGCAGTTGTTGGG + Intergenic
974684996 4:65216007-65216029 CAGTGGCAGCAAGGGTTGTTGGG - Intergenic
974811074 4:66946825-66946847 CAGTAGCAGCCCCAGTTGAGTGG - Intergenic
976294350 4:83455132-83455154 CAGTAGGAGCTGCAGTTATCTGG + Intronic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978766821 4:112413147-112413169 CAGAAGGAACAACAGTTGTTAGG - Intronic
980317959 4:131229813-131229835 CATTTCCAGCATCAGTTGTTAGG - Intergenic
980946157 4:139322580-139322602 CATGAGCACCAGTAGTTGTTAGG + Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981250908 4:142599195-142599217 CAGTAGTGGCAGCAGTGGGTTGG - Intronic
981359812 4:143833194-143833216 CAGTAGAAGCCACAGTTCTTGGG - Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
983805019 4:171983811-171983833 GGAGAGCAGCAGCAGTTGTTAGG - Intronic
984797062 4:183671462-183671484 CAGAAGCAGGAGCAGCAGTTGGG - Intronic
986431525 5:7685650-7685672 CAGCAACAGTAGCAGTTGTTGGG + Intronic
988635036 5:32974012-32974034 CAGTAACAGGAGCAGTGGTTTGG - Intergenic
988699485 5:33659304-33659326 CACTAGCAGCAGCAGTTACTGGG + Intronic
992185638 5:74241859-74241881 CAGTAGCAGCAGCATTACCTGGG + Intergenic
992542458 5:77778431-77778453 CAGTAGCAGCAGAGGTCTTTTGG - Intronic
993579349 5:89639877-89639899 AAGTAGTAGCAGCAGTGGATAGG - Intergenic
994150559 5:96442783-96442805 CAACAGCAGCAGCAGTGGTAGGG - Intergenic
994644741 5:102454088-102454110 CAGAGGCAGCAATAGTTGTTAGG - Intronic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995304713 5:110631541-110631563 CAGTGGCAGCAGCAGTGGCTGGG - Intronic
996139860 5:119893766-119893788 CAATTTCATCAGCAGTTGTTGGG - Intergenic
996397673 5:123029737-123029759 AAGTAGCAGCAGCGTTTGTCTGG - Intronic
997023406 5:130028905-130028927 CAGTAGGAGAAGCAGATGTGGGG - Intronic
997895724 5:137715110-137715132 CAGAAGCAGCAGCTGTGGTCTGG + Intronic
998049715 5:139022239-139022261 GGGTAGCAGCCACAGTTGTTGGG - Intronic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
999928002 5:156400243-156400265 CAATAGCAGCAGCATTACTTGGG - Intronic
1001240851 5:170068868-170068890 CAGTAGCAGCAACAGTACTTTGG - Intronic
1002088748 5:176792453-176792475 CAGGTGCTGCAGCAGGTGTTGGG + Intergenic
1002276677 5:178108500-178108522 CAGAAGCAGTAGCAGTGGCTTGG + Intergenic
1005033921 6:21537823-21537845 CAGCAGCTGCAGCAGTTGGAGGG - Intergenic
1005856172 6:29864483-29864505 CATTAGGAACAGGAGTTGTTTGG - Intergenic
1005862005 6:29908786-29908808 CATTAGGAACAGGAGTTGTTTGG - Intergenic
1007058151 6:38909179-38909201 CAGCTGCAGGAACAGTTGTTTGG - Intronic
1007308592 6:40926784-40926806 CAGAAGAAGCAGCAGTAATTGGG - Intergenic
1007472207 6:42098369-42098391 CAGGAGCAGCACCAGATGCTGGG + Intergenic
1007534366 6:42572022-42572044 CAGCAGCAGCATCATTTCTTAGG - Intronic
1007886189 6:45232897-45232919 CAGGAGCAGCAACAGTGGCTGGG + Intronic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1011744153 6:90393079-90393101 TAGTAGCAGCAGCAGTAGCTAGG + Intergenic
1011787105 6:90859281-90859303 TAGTAACAGCAGCAGTGATTTGG - Intergenic
1013164885 6:107580796-107580818 AAGTAGGAGGAGCAGGTGTTGGG + Intronic
1015112221 6:129606126-129606148 CAGCAGAAGCAGCTGCTGTTAGG + Intronic
1016321282 6:142848802-142848824 GAATGGCAGCAGCAGTTATTTGG - Intronic
1017336673 6:153269026-153269048 CAGTGGCAGCAGCTGTGGGTGGG - Intergenic
1018210474 6:161476317-161476339 CAGAAGCAGCAGCTTTTTTTAGG - Intronic
1018231885 6:161683037-161683059 AAGGAGCAGCAGCAGTTTTTAGG + Intronic
1018367352 6:163134734-163134756 CATTAGTAGTAGTAGTTGTTAGG - Intronic
1018497102 6:164359752-164359774 CTGTATCAGAAACAGTTGTTTGG + Intergenic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019527349 7:1486746-1486768 CAGAAGCAGCGGCAGCTGCTGGG - Exonic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022898946 7:34782422-34782444 CAGTAGCAGCAAGAATTGATAGG - Intronic
1024626939 7:51215890-51215912 CTCTTGCAGCAGCAGGTGTTGGG - Intronic
1024822853 7:53353580-53353602 CAGTAGCTCAAACAGTTGTTGGG + Intergenic
1025023052 7:55495091-55495113 CAGTAGCTGCACCAGTCCTTGGG - Intronic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1030579450 7:111335021-111335043 CTGTAGCAGGAGCAGTTTATAGG + Intronic
1031557427 7:123194836-123194858 CAGAAGGAGCAGCAGGTTTTGGG + Intronic
1032904502 7:136348662-136348684 CAGTGCCAGCAGCTTTTGTTAGG + Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036633668 8:10532709-10532731 CAGTAGCTGTGGGAGTTGTTGGG + Intronic
1037435264 8:18856056-18856078 CAGAAGGAGCAGCAGCTGCTTGG - Intronic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1043285475 8:78523463-78523485 GGGTAGAAGCAGCAGTTTTTTGG + Intronic
1043361253 8:79475141-79475163 CAGTAGGTGCAGCAGTTGTAGGG - Intergenic
1043618857 8:82162661-82162683 CAGCAGCAGCAGAACTTGTCAGG - Intergenic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1046670941 8:117055418-117055440 CAGGGACAGCAGCAGTTGCTGGG + Intronic
1048036280 8:130680330-130680352 CTGTAGCAGCAGCTGTGGTGTGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1050042683 9:1512584-1512606 CAGAAGAAACAGCAGTTGGTTGG + Intergenic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1052004082 9:23325233-23325255 CAGTAGAAACTGGAGTTGTTTGG - Intergenic
1052181810 9:25538026-25538048 CAGAAGTATCAGCAGTTGCTTGG + Intergenic
1055097297 9:72426467-72426489 AAGTAGCATCAGCAGTCTTTGGG + Intergenic
1055707821 9:79026532-79026554 CTGGAGCAGCAGGTGTTGTTGGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1057932948 9:99211979-99212001 CTGCAGCAGCAGCAATGGTTGGG + Intergenic
1059344096 9:113616592-113616614 CAGTACCAGCTGCAGGTCTTGGG - Intergenic
1060160959 9:121363293-121363315 CAGTTGCAGCAGCACTTTTTAGG + Intronic
1060367441 9:123032490-123032512 CTGAAGCAGCAGCAGTTGTCTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1185738873 X:2514278-2514300 AAGAAGCAGAAGAAGTTGTTTGG + Intergenic
1186976736 X:14915778-14915800 TAGTAGCCACAGCAGGTGTTGGG + Intronic
1187957020 X:24529452-24529474 CACTAGCAGAAGCATTTCTTCGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188441561 X:30218775-30218797 CCGCAGCAGCGGCAGTGGTTGGG - Exonic
1188504864 X:30871521-30871543 CAGTAGCAGCTGCTGCTCTTAGG + Intronic
1189144551 X:38642601-38642623 CAGTAGCAGGAGCCTTGGTTTGG - Intronic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1191600044 X:62993463-62993485 CAGTAGCAGCCATAGATGTTGGG - Intergenic
1191684838 X:63879238-63879260 CAGTGGCAGCAGCCATTGGTAGG - Intergenic
1191798139 X:65045345-65045367 AAGTAGCAGCAGGATTTGATAGG - Intergenic
1192989594 X:76435234-76435256 GAGAAGCAGCTGCAGTTGATTGG - Intergenic
1193431900 X:81417707-81417729 CGGTAGAAATAGCAGTTGTTTGG + Intergenic
1195419802 X:104661995-104662017 CATTAGCAACAGCAGTTGTAGGG - Intronic
1197309286 X:124884064-124884086 CAGTGGCAGCAGCAATTGTCAGG + Intronic
1198044944 X:132892325-132892347 CAGTAGCAGCAGCAGCACCTTGG + Intronic
1199697564 X:150353614-150353636 CAGGAGCAGCAGCAGGTTCTAGG + Intergenic
1202044808 Y:20727317-20727339 CAGACGCAGCAGCAGAAGTTCGG + Intergenic