ID: 1178518027

View in Genome Browser
Species Human (GRCh38)
Location 21:33265038-33265060
Sequence CAGTTTAAGGACTGGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178518027 Original CRISPR CAGTTTAAGGACTGGGACTC AGG Intronic
904326239 1:29728413-29728435 CAGAGTAAGGACTTGAACTCAGG + Intergenic
904593687 1:31629604-31629626 CAGTTTTAGGGCTGGCATTCTGG - Intronic
905259191 1:36705674-36705696 CAGAGTTAGGACTGGGACTCAGG + Intergenic
905299455 1:36976590-36976612 CAGATTGAGGATTGGGACCCAGG + Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907134027 1:52122323-52122345 CAATTTCAGGACTGGAACCCAGG - Intergenic
908582021 1:65525927-65525949 CCGCTTAGGGACTGGGAGTCCGG + Intronic
908725662 1:67173976-67173998 CAGTTTAAGTACTTGGCCTTTGG - Intronic
910646306 1:89519108-89519130 CAGCTGAACCACTGGGACTCTGG + Intergenic
914246255 1:145887743-145887765 CAGTTTGAGGCCTGGTGCTCTGG - Intergenic
915705185 1:157836933-157836955 CAGTTTCATGACTAGAACTCTGG + Intronic
919578483 1:199341008-199341030 AAGTTTTTGGACTGAGACTCTGG - Intergenic
919701705 1:200638006-200638028 AATTTTAAGGGCTGGGAGTCAGG - Intronic
920212928 1:204341425-204341447 CAGATAAAGAACTGGGAGTCTGG + Intronic
921224129 1:213000163-213000185 CAGAGTCAGGACTGGAACTCAGG + Intronic
1063340011 10:5253954-5253976 AAGTTTCAGGACTGGGATTCTGG + Intergenic
1063343725 10:5292697-5292719 AAGTTTCAGGACTGGGCTTCTGG - Intergenic
1064929120 10:20604100-20604122 CAGTTGAGGAACTGGGACTCTGG - Intergenic
1065429042 10:25634870-25634892 CAGTTTAAGGCCAGGGACTCAGG - Intergenic
1065507596 10:26444798-26444820 CAGTTTAAGAAATGGGACATAGG + Intronic
1066135847 10:32445812-32445834 CAGATGAAGGACTGGGGCTCTGG + Intergenic
1072584925 10:96773091-96773113 CAGTATAAGGAAGGTGACTCTGG + Intergenic
1074036230 10:109741626-109741648 CTGTTTAAGAGCTGGGCCTCTGG - Intergenic
1078155205 11:8794258-8794280 CAGAGTGGGGACTGGGACTCAGG - Intronic
1082813334 11:57491886-57491908 CAGTGGAAGGTCTGGGGCTCAGG - Intronic
1085129361 11:74024879-74024901 CAGTTTTAGCACTGGAACCCAGG - Intronic
1085363596 11:75916200-75916222 CAGTTTTAGGACTGGAATTTAGG - Intronic
1085549663 11:77356977-77356999 CAGTATAAGGACAGGGAATGTGG + Intronic
1086105438 11:83141906-83141928 CATTTTAAGAACTGAGACTTAGG - Intergenic
1086670905 11:89546452-89546474 CAGGATAAGAGCTGGGACTCAGG + Intergenic
1086773376 11:90797588-90797610 CTGTTTAAGAACTTGGACTTTGG - Intergenic
1087064208 11:94011975-94011997 CTGTTGAAGGACTGGGCCACTGG - Intergenic
1090403817 11:126465656-126465678 CAGCTGCAGGCCTGGGACTCAGG + Intronic
1092986281 12:13849190-13849212 CAGGACAAGAACTGGGACTCTGG + Intronic
1098271936 12:68777804-68777826 CTGTTTATGGACTGGTACTGGGG - Exonic
1098312782 12:69164265-69164287 GAGAATGAGGACTGGGACTCAGG + Intergenic
1100897581 12:99201533-99201555 ATGCTTAAGGACTGGGTCTCTGG - Intronic
1102040308 12:109796622-109796644 AAGTTCAAGGACTGGGCCTATGG - Exonic
1102856482 12:116298930-116298952 GAGATTAAGAGCTGGGACTCTGG + Intergenic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1105999835 13:25711326-25711348 CAGTTTCAGGATTTGAACTCTGG + Intronic
1106996729 13:35492791-35492813 CACTTAAAGCACTGGGACTGAGG + Intronic
1115752959 14:36508489-36508511 CGGGGTAAGGACTGGGACTGGGG + Intronic
1118452836 14:65919494-65919516 CAGTTTAAGAAAAGGGACTAGGG - Intergenic
1123676057 15:22711028-22711050 CAGTTAAGGGACTGGGTTTCGGG - Intergenic
1124163444 15:27295806-27295828 CCCTTTTAGGAGTGGGACTCAGG - Intronic
1124335809 15:28856349-28856371 GAGTTTAGGGTCTGGGGCTCAGG - Intergenic
1124464527 15:29924895-29924917 GAATTTAAGCACTGGGACTATGG - Intronic
1126395162 15:48207899-48207921 CAGCTTTAGGCCTGGGAATCAGG + Exonic
1126813994 15:52437121-52437143 CAGTTTATGGACTGTGTCCCTGG - Intronic
1127353839 15:58179292-58179314 CAGTGAAAAGTCTGGGACTCAGG - Exonic
1128311491 15:66633907-66633929 CAGTGACAGGACTGAGACTCAGG - Intronic
1129231069 15:74197479-74197501 GAGTTTGAGGGCTTGGACTCAGG + Intronic
1131549092 15:93341394-93341416 CAGTTTAAGGAATAGGCATCAGG + Intergenic
1133801732 16:9090847-9090869 CCGTCTAAGAAATGGGACTCTGG + Intergenic
1137247054 16:46714462-46714484 GGGTTGAAGGACTGGGCCTCGGG + Intronic
1139325550 16:66150148-66150170 CAGTTTAAGATGGGGGACTCAGG - Intergenic
1140302370 16:73770954-73770976 AAGGTAAAGGACTGGGATTCAGG + Intergenic
1140829743 16:78740201-78740223 AAGTTGAAGAAATGGGACTCAGG + Intronic
1142044644 16:87917977-87917999 CAGTGTCGGGACTGGGACTGTGG - Intronic
1145030834 17:19503957-19503979 CCCTTTAAAGACTAGGACTCTGG - Intronic
1150116052 17:62550475-62550497 CAGAGTAAGGACTGGGTCTGTGG + Intronic
1150462266 17:65362608-65362630 CAGATACAGGACTGGGACTCAGG + Intergenic
1151029361 17:70718419-70718441 CAGGGTAAGGACTGAGACTGAGG - Intergenic
1151422701 17:74008852-74008874 CAGTTCCGGGAGTGGGACTCAGG + Intergenic
1151493080 17:74444066-74444088 GAATTTAAGAACTGGGGCTCTGG - Intronic
1151532714 17:74717271-74717293 CAGTGTATGGAATGGGAATCTGG + Intronic
1151932093 17:77238919-77238941 CAGATCAGGAACTGGGACTCTGG + Intergenic
1153994250 18:10426054-10426076 CAGTTGAAGGACTGGGTCAGAGG - Intergenic
1154052009 18:10970093-10970115 AAGTTTAATGACTGATACTCTGG + Intronic
1156992656 18:43428339-43428361 CAGTGCAAGGACTCAGACTCTGG + Intergenic
1158653757 18:59309941-59309963 CAGACTTAGGACTGGAACTCAGG - Intronic
1161690987 19:5734118-5734140 CAGTCTACGGATGGGGACTCAGG - Intronic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1163464680 19:17460433-17460455 CAGTATATGGACTGGCACACAGG + Intronic
1164261291 19:23570326-23570348 CATTTTATGGACTGGGAAACAGG + Intronic
1165472817 19:36013359-36013381 CGGTTCCAGGGCTGGGACTCTGG + Exonic
1165604212 19:37086153-37086175 CATTTTATGGACTGGGACCAGGG - Intronic
1166250394 19:41565384-41565406 CAGGGTAAGGACTGGCTCTCAGG - Intronic
1166763082 19:45236579-45236601 GGGGTTTAGGACTGGGACTCAGG + Intronic
1167780394 19:51595066-51595088 CAGGTTTAGGACAGGGAATCTGG - Intergenic
1167805143 19:51777674-51777696 CAGCTGAAGGACTGGGGCTGAGG + Intronic
925723130 2:6847263-6847285 CAGTTTTTGGACTGTGAGTCTGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
932316688 2:70789608-70789630 CACGTTCAGGACTGGGACTGGGG - Intronic
937016666 2:118611969-118611991 GAGGTTAAGGACGGGGTCTCTGG + Intergenic
937023933 2:118681973-118681995 GAGTTAAAAGACTGGGTCTCAGG + Intergenic
940330757 2:152471916-152471938 CAGTTTCAGTAGTGCGACTCCGG + Intronic
944140732 2:196453255-196453277 CAGTTTAGGGTCTTGGACTGGGG + Intronic
945235119 2:207625950-207625972 CACTTTAAAAACTTGGACTCGGG - Intergenic
945344886 2:208701622-208701644 AAGTTGAAGGACTTGGAGTCTGG + Intronic
946748200 2:222866569-222866591 CAGGTTAAGAACAGGGACTCTGG - Intronic
1171119847 20:22558728-22558750 CAATTTAAGGACTTAGAGTCAGG - Intergenic
1172111066 20:32545359-32545381 AAGTTCAAGGACTGGGGCTTGGG - Intronic
1174796614 20:53527819-53527841 CAGTCTGTGGACTGAGACTCAGG - Intergenic
1175855810 20:62120424-62120446 GAGTTTAAGGAAGGGGACACAGG - Intergenic
1178518027 21:33265038-33265060 CAGTTTAAGGACTGGGACTCAGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179493545 21:41756979-41757001 CAGCCTCAGGACTGAGACTCTGG - Intronic
1180624620 22:17185975-17185997 CATTTTAAGGACTGGAATACGGG + Intronic
1182118239 22:27770287-27770309 CTGTCTATGGACTGTGACTCTGG - Intronic
1183838119 22:40473989-40474011 CAATATAAGGATTGGGAATCAGG + Intronic
949410943 3:3763702-3763724 ATGTTTAAGGATTGGGAGTCAGG - Intronic
950153368 3:10705555-10705577 CAGTGCAAGCACTTGGACTCTGG + Intronic
952035687 3:29197681-29197703 CAGTTTAAAGCCTGAGTCTCAGG - Intergenic
954643494 3:52116420-52116442 CAGTTCAAGCACTGAGGCTCTGG + Intronic
955041030 3:55318058-55318080 AACTTTAAGGACTGGCACTTTGG - Intergenic
955054422 3:55443270-55443292 CAGTTTAAGAAAAGGGACTCTGG - Intergenic
956501058 3:69885612-69885634 CGGTTTATGTACTGGGACTTTGG - Intronic
960381889 3:116972875-116972897 CAGTTGAATCTCTGGGACTCTGG + Intronic
961764403 3:129197791-129197813 CAGGGTATTGACTGGGACTCGGG + Intergenic
961845334 3:129758143-129758165 CAGTTTCAGGACTGTGGATCTGG - Intronic
963368645 3:144369384-144369406 CAGTGTTATGACTGGGGCTCTGG - Intergenic
964507680 3:157417467-157417489 GAGTTTAAGGGCTATGACTCTGG - Intronic
964854779 3:161135044-161135066 AAGTTTGAGGACTGCAACTCAGG - Intronic
964880689 3:161419510-161419532 CAGTTTCAAGACTGGGAAACTGG - Intergenic
967771118 3:193334327-193334349 CATGTAAAAGACTGGGACTCAGG + Intronic
968982742 4:3859390-3859412 CGGTCTAAGTACTGGGGCTCAGG + Intergenic
970035797 4:11734617-11734639 CAGATTAAAAACTGGGATTCAGG + Intergenic
970359628 4:15295926-15295948 CAGTTTAAGGATGGGTTCTCTGG + Intergenic
970785690 4:19793498-19793520 CTGTTCAAGTACTGGGACTAGGG - Intergenic
971454434 4:26830767-26830789 CAGTTTGAGGACAGGAACACAGG - Intergenic
971696472 4:29910946-29910968 CAGTTTTAGGGCAGAGACTCTGG - Intergenic
973179968 4:47255136-47255158 CAGAGTCAGGACTGGAACTCAGG - Intronic
974028957 4:56758667-56758689 CACTTGAAGGGCTGGGACTAGGG + Intergenic
974568428 4:63609966-63609988 CGGTTTTAGGTCTGGGACACAGG - Intergenic
976968405 4:91074625-91074647 CAGTTTGGGGACTTGAACTCTGG - Intronic
977229086 4:94430630-94430652 CTGTTTTAGGAATGTGACTCTGG - Intergenic
981765010 4:148239299-148239321 CATTTTACAGACTGGGACCCTGG - Intronic
985124734 4:186682156-186682178 CAGATTCAGGACTAGGAATCAGG + Intronic
986686969 5:10283168-10283190 CACTTTATGGACTGGGAATCAGG + Intronic
988373815 5:30407471-30407493 CAGTTTCAGAGCTGGGAGTCAGG + Intergenic
989542522 5:42634029-42634051 CAGTTTAAGTACTCAGCCTCTGG + Intronic
989791040 5:45402193-45402215 ATGTTTAAGGACTCAGACTCTGG - Intronic
990828441 5:59928792-59928814 CATTTTAAGGTCTGGAACTTTGG - Intronic
998936901 5:147238456-147238478 CAGTTTTAGGACTGGAACACAGG + Intronic
1000135185 5:158341278-158341300 CAGTTGTAGGACTGAGGCTCTGG + Intergenic
1001755376 5:174164538-174164560 CAGTTTAAAGAATGTGACTGTGG - Intronic
1005851591 6:29827431-29827453 CAGTTCAGGGACAGGGATTCCGG + Intronic
1005857296 6:29872268-29872290 CAGTGAAAGGCCTGGGATTCTGG + Intergenic
1009317554 6:62239970-62239992 AAGTTTAAGGCCTGGTACTGTGG - Intronic
1012244337 6:96909638-96909660 CAGGTTCAGGACTAGAACTCAGG + Intergenic
1012269000 6:97184297-97184319 AAGTTTGAGGACTGGGCCTTAGG - Intronic
1012902878 6:105028266-105028288 CATTTTAAGGACTTTGATTCTGG + Intronic
1013991713 6:116261494-116261516 CAGCTTAAGGGCTGAGACTATGG + Intronic
1014017518 6:116550360-116550382 AAGTGCCAGGACTGGGACTCAGG - Intronic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1015604745 6:134943200-134943222 CTTTTTAAGGGCTTGGACTCAGG + Intronic
1018058083 6:160069466-160069488 CATTTTAGGGACTGGGAAACAGG + Intronic
1018713402 6:166513749-166513771 CACTTTAACGACTGGGACAGTGG - Intronic
1018950181 6:168374015-168374037 CAGTTTAAGCCCTGGGATTTGGG - Intergenic
1026122799 7:67552156-67552178 CAGGGTATGGACTGGGAATCTGG + Intergenic
1026590912 7:71694804-71694826 ATGGTTAAGGACTTGGACTCTGG - Intronic
1028450925 7:90982363-90982385 CAGTTTTATGCCTGGCACTCAGG + Intronic
1033306978 7:140231917-140231939 CAGGTTTGGGACTGGAACTCAGG + Intergenic
1035574123 8:694215-694237 TAGTTTAAGAACTAGGATTCCGG - Intronic
1037503107 8:19504644-19504666 GAGGTTAAGGACATGGACTCTGG + Intronic
1039681663 8:39744775-39744797 TACTTTAAGTACTGGGACACAGG - Intronic
1040041890 8:42924670-42924692 CAGTTTAAAGACTGTGTCACTGG + Intronic
1041967854 8:63701389-63701411 CAGTTTAATTACTGGAAATCAGG - Intergenic
1042800064 8:72708835-72708857 CAGTTTAAAGAATGAGAATCTGG + Intronic
1043529127 8:81130352-81130374 CAGTTTAAGGAATGGGGTACAGG + Intergenic
1047066959 8:121295154-121295176 CAGTTTAAGGAGTGGGGATAGGG + Intergenic
1047252801 8:123193280-123193302 CAGCTTAGGGTCAGGGACTCAGG + Intronic
1047599389 8:126411031-126411053 CAGAATAGGGACTGGAACTCAGG - Intergenic
1048137951 8:131764691-131764713 AAGTTTGAGGACTTGCACTCTGG - Intergenic
1048260131 8:132938258-132938280 CAGATCAAGCTCTGGGACTCAGG - Intronic
1048321763 8:133405631-133405653 GAGGCTAGGGACTGGGACTCTGG + Intergenic
1048402777 8:134087466-134087488 CAGTATATGGCCTGGGACTCAGG + Intergenic
1049849952 8:144825757-144825779 GAGTTTAAGGGATTGGACTCAGG + Intergenic
1049868118 8:144952248-144952270 GACTTTGGGGACTGGGACTCAGG - Intergenic
1050101493 9:2124612-2124634 CAGATTAGAGCCTGGGACTCGGG + Intronic
1053514491 9:38718478-38718500 CAGGTTTAGGTCTTGGACTCAGG + Intergenic
1056514436 9:87336562-87336584 CAGATGAAGGACTGGTGCTCAGG + Intergenic
1060904347 9:127291517-127291539 CAGAGGAAGTACTGGGACTCGGG - Intronic
1061438008 9:130579087-130579109 CAGTGTAAGAACTGGGGCCCGGG + Intronic
1186260949 X:7778911-7778933 CAGTTTAATCCCTTGGACTCTGG - Intergenic
1186607550 X:11107891-11107913 CAGTTTCTGGACTGGCACTTGGG - Intergenic
1188296063 X:28450671-28450693 ATCTTTAAGGAGTGGGACTCTGG - Intergenic
1190171865 X:48117377-48117399 CATCTTATGGACTGGGAATCTGG - Intergenic
1192024439 X:67433795-67433817 CAGATTCAGGACTCAGACTCTGG + Intergenic
1192059107 X:67804916-67804938 CATTTTAAGGACTTGTACCCAGG - Intergenic
1193137506 X:77988559-77988581 CAGTTTAGATACTGGGACACTGG + Exonic
1193367178 X:80649137-80649159 CAGAGTAAGGACTGGAACCCAGG + Intergenic
1197726662 X:129781249-129781271 CAGCTGAAAGACTGAGACTCGGG + Intronic
1199905158 X:152220189-152220211 CAGATTAAGCAATGGGATTCAGG - Intronic
1200085420 X:153601948-153601970 CATTTCAAGGAATAGGACTCGGG + Intergenic
1201278750 Y:12322184-12322206 CAGTTGCAGGCCTGGGACCCTGG + Intergenic
1201409482 Y:13684682-13684704 CAGTTTGGGGGCTGGGACTATGG - Intergenic