ID: 1178521163

View in Genome Browser
Species Human (GRCh38)
Location 21:33289448-33289470
Sequence GAGGGCCCGCTCTCCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178521154_1178521163 21 Left 1178521154 21:33289404-33289426 CCACAAAGGAATGCTTGTGGGCT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 14
4: 225
1178521159_1178521163 -10 Left 1178521159 21:33289435-33289457 CCTCCGCTGCCCTGAGGGCCCGC 0: 1
1: 0
2: 2
3: 30
4: 336
Right 1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 14
4: 225
1178521158_1178521163 -6 Left 1178521158 21:33289431-33289453 CCTTCCTCCGCTGCCCTGAGGGC 0: 1
1: 0
2: 4
3: 21
4: 406
Right 1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178521163 Original CRISPR GAGGGCCCGCTCTCCTCTCC CGG Intronic
900109048 1:998001-998023 GAGGGCTCGCTCGCCTCCCGTGG + Intergenic
900585515 1:3430651-3430673 GAGCGCTTGCCCTCCTCTCCCGG + Intronic
901069233 1:6509033-6509055 GAGGGCCCGCCTGCCTCTCTCGG - Intronic
901228635 1:7629777-7629799 CAGGTCCTGCCCTCCTCTCCAGG + Intronic
902039078 1:13479861-13479883 CAGGGTCCCCTCTTCTCTCCTGG + Intronic
902625293 1:17672945-17672967 CAGGCCCCTCTCTCCTCACCTGG + Intronic
902875182 1:19336698-19336720 TCAGGCCCGCTCTCCTCTCAGGG - Intergenic
903276010 1:22222309-22222331 GCGGGCCCCTTCTGCTCTCCTGG + Intergenic
903996234 1:27306979-27307001 GAGCACCCTCGCTCCTCTCCTGG + Exonic
904199757 1:28812178-28812200 GTCCGCCCGCTCTCCTCGCCCGG - Exonic
904835982 1:33336687-33336709 GAGGGACGGCCCTCCTCTACGGG + Intronic
906325291 1:44841969-44841991 CAGGGCCTGCTCTTCTCTCTGGG - Exonic
908807759 1:67948541-67948563 TAGGGCCCCTTCTCCTCCCCCGG + Intergenic
910448231 1:87320339-87320361 CAGGGACCGCTCTCAGCTCCTGG + Intergenic
912385221 1:109268130-109268152 GAGGGCCCCCTCTGCCCCCCAGG - Intronic
914045197 1:144085630-144085652 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
914132913 1:144875056-144875078 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
916625539 1:166551900-166551922 GAATGCCTACTCTCCTCTCCAGG - Intergenic
920073663 1:203321485-203321507 AAGGTCTCGCTCTCCACTCCTGG - Intergenic
920848283 1:209611549-209611571 GAGGGTAAGCTGTCCTCTCCAGG + Exonic
922505515 1:226123369-226123391 AGGGGACCCCTCTCCTCTCCAGG + Intergenic
922742709 1:228023120-228023142 GAATGCCCGCTTTCCTCTCCAGG - Intronic
923729476 1:236536657-236536679 CAGGGCCTGCTCTTCTCTGCTGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063372809 10:5532779-5532801 CATGGCCTCCTCTCCTCTCCAGG + Intergenic
1065974155 10:30827997-30828019 GTCGGCCCCCTCTCCTCCCCTGG - Intronic
1066957312 10:42185323-42185345 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
1069619443 10:69827591-69827613 AAGGGGCTGCTCTCCCCTCCAGG - Intronic
1070743622 10:78919229-78919251 GCGGCCCTGCTCTCCTGTCCTGG - Intergenic
1070828250 10:79403663-79403685 CAGGGCCCCCTCCCCTCTTCTGG + Intronic
1074405611 10:113178097-113178119 GAGGCCCTGCTCGCCTCTCCTGG + Intergenic
1075728301 10:124621983-124622005 GAGGGTTTGCTCTCCTCTCAAGG - Exonic
1075786468 10:125053452-125053474 GAAGGCCCTCTGTCCTCTCCAGG + Intronic
1076757195 10:132578779-132578801 GAGAGTCTCCTCTCCTCTCCTGG - Intronic
1077009516 11:373958-373980 GAGGGTCTGCTCTGCCCTCCTGG + Intronic
1079377563 11:19907240-19907262 GAGAGCCAGTTCTCCACTCCTGG + Intronic
1083260119 11:61518246-61518268 GAGTGGCCTCTCTCCACTCCAGG + Exonic
1085624911 11:78064387-78064409 CACTGCCCCCTCTCCTCTCCTGG - Intronic
1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG + Intergenic
1086210423 11:84311752-84311774 CAGGCCCCACCCTCCTCTCCAGG + Intronic
1088965781 11:114719773-114719795 CAGGGCCCACTCACCTCTCAAGG - Intergenic
1090326004 11:125887210-125887232 GAGCGCCCGCCCTCGTCTCCCGG + Exonic
1091133406 11:133165733-133165755 GCAGGCCCTCTCTCCTCCCCAGG + Intronic
1091288273 11:134421348-134421370 GAGGGCCCCTTCTCCCTTCCTGG - Intergenic
1091564673 12:1639636-1639658 GCGGGTGCGCTCTCCTCTCCCGG - Intronic
1092161100 12:6315967-6315989 GAGGGCCCACCCTCATCCCCAGG - Intronic
1095671166 12:44861563-44861585 GAGGGCCAGCTCAGCTCTCGGGG - Intronic
1098290360 12:68952003-68952025 GAGTTTCCTCTCTCCTCTCCGGG + Intronic
1098949722 12:76627330-76627352 CAGTGACCTCTCTCCTCTCCAGG - Intergenic
1101446878 12:104742891-104742913 GAGTCCCCGCTCTTCTCTCTTGG + Intronic
1101545412 12:105707534-105707556 GAGGGACTCCTCTCCACTCCGGG + Intergenic
1101559643 12:105844328-105844350 TAAGCCCCGCTCTCCTCTACTGG + Intergenic
1102799534 12:115719419-115719441 CTGGGCCCTTTCTCCTCTCCAGG - Intergenic
1103031246 12:117615142-117615164 GAGCACCCACTCTCTTCTCCTGG + Intronic
1104775878 12:131389851-131389873 GAAGACCCGCCCTCCTCTGCTGG + Intergenic
1104801208 12:131556232-131556254 GACTGCCCTCTCCCCTCTCCTGG - Intergenic
1105023647 12:132834599-132834621 GACAGCCTGCCCTCCTCTCCTGG + Intronic
1105449754 13:20488851-20488873 CAGGGACCACTCACCTCTCCAGG + Intronic
1107873065 13:44764647-44764669 TGGGGCCCACTCTCCTCCCCAGG + Intergenic
1109450826 13:62512473-62512495 CATGACCCCCTCTCCTCTCCAGG + Intergenic
1112529133 13:100183484-100183506 GATGGCCAGCTATCCTCTCCTGG - Intronic
1113834034 13:113317111-113317133 GAAGGCCCCTCCTCCTCTCCCGG - Intronic
1115147117 14:30238804-30238826 GAGGGCCCCCTCTCCTCACCAGG + Intergenic
1116136039 14:40925073-40925095 GGGGGCATGCTCTCCTCTACTGG - Intergenic
1117071700 14:52063303-52063325 GAGGCCCCTCTCTCCTCTCTGGG - Intronic
1121105996 14:91280072-91280094 CAGGGCCTGCACACCTCTCCTGG + Intronic
1121276460 14:92671349-92671371 GAGTGCACTCTCCCCTCTCCAGG - Intronic
1121280096 14:92691881-92691903 GAGGGCTCCCTGGCCTCTCCTGG + Intergenic
1122718274 14:103708011-103708033 CAGGGCCCTCTCTCCCCTGCAGG - Intronic
1202935788 14_KI270725v1_random:86457-86479 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1127674687 15:61228482-61228504 GAGCGCCCCCTCTCCACCCCCGG + Intronic
1128114869 15:65098958-65098980 GGGGGCCCTCACTCCTCTGCAGG + Intronic
1128162868 15:65435881-65435903 GAGGGCGCACTGTGCTCTCCAGG - Intergenic
1128551057 15:68598199-68598221 GACTGCCCGCCCTCTTCTCCAGG - Intronic
1129933765 15:79432499-79432521 CAGGGCCCGCCCTTCTCTGCGGG - Exonic
1132832517 16:1935739-1935761 GTGTGTCCTCTCTCCTCTCCAGG + Intergenic
1132878958 16:2152890-2152912 GAGGCCCGGCTGTCCTCACCTGG + Intronic
1133270631 16:4609500-4609522 GAGTCCGCGCTCTCCCCTCCAGG + Exonic
1133381386 16:5333568-5333590 CAGGGCCCGAGCTTCTCTCCTGG + Intergenic
1134261999 16:12658655-12658677 GAGGTCCCGCTCTGTTGTCCAGG - Intergenic
1136049203 16:27638594-27638616 GAGGGACCACAGTCCTCTCCCGG + Intronic
1138588426 16:57986048-57986070 GAGGGCCCCTCCTCCTCGCCAGG - Intronic
1139321508 16:66118037-66118059 GAAGGCCCTCTCCCCTCTCTGGG + Intergenic
1140041563 16:71411848-71411870 GAGGGCCCTAGCTCCTTTCCTGG + Intergenic
1141722626 16:85765282-85765304 GAGAGCCAGCTCACCTCCCCAGG + Intergenic
1141840220 16:86568970-86568992 GCGTGCCCGCTCTCTGCTCCCGG - Exonic
1141864049 16:86737631-86737653 GAGGGTCACCTCACCTCTCCTGG + Intergenic
1142144019 16:88485212-88485234 GAGGGCCCACTCGCAGCTCCAGG + Intronic
1142188638 16:88706691-88706713 GAGGTCCCGCTCTCCACGCGGGG - Intronic
1142685749 17:1576021-1576043 GAGGGCCAGATTTCCTCACCAGG - Intronic
1143109504 17:4545378-4545400 CAGCCCCCGCCCTCCTCTCCAGG + Intronic
1145018328 17:19412910-19412932 CAGGGGCCCCTCTCTTCTCCTGG + Intronic
1145970064 17:28951152-28951174 GAGGGGCCGCTCCCCCCTCGCGG - Exonic
1146302424 17:31699918-31699940 GTGCGCCCACTCTCTTCTCCAGG - Intergenic
1146630387 17:34465320-34465342 GAGGTCCCGGGCTGCTCTCCTGG + Intergenic
1146909919 17:36641871-36641893 TAGGGCCCCCTCCCCTTTCCGGG + Intergenic
1147604588 17:41767369-41767391 GAGGGCCCACCTTGCTCTCCTGG + Exonic
1147816022 17:43211602-43211624 GAGGGCCCGGGTTGCTCTCCTGG + Exonic
1148832189 17:50440835-50440857 GTGAGCCAGCTCACCTCTCCTGG - Intronic
1149989787 17:61376508-61376530 TAGGAATCGCTCTCCTCTCCAGG + Intronic
1150483459 17:65528229-65528251 GAGGGCCTCCTCTCATCCCCTGG + Intergenic
1151545456 17:74790315-74790337 GCGGGCCCGCACTTCCCTCCGGG + Intronic
1152641004 17:81449233-81449255 CAGGGCCAGCTCTGCCCTCCGGG + Intronic
1152768908 17:82155750-82155772 CTGGGCCCGCCCTCGTCTCCAGG + Intronic
1153848364 18:9069973-9069995 GAAGGCCGTCACTCCTCTCCAGG + Intergenic
1155054365 18:22171284-22171306 GGGGCCCCGCTCTCCGCCCCGGG - Exonic
1155221576 18:23690038-23690060 AAGGGCCCGATCCCTTCTCCGGG - Intronic
1158844122 18:61423251-61423273 GAGGGCCCCCTGCCCTCTCAGGG + Intronic
1159292240 18:66438416-66438438 GAGGGCCAGTTGTCATCTCCAGG + Intergenic
1160698994 19:497335-497357 CCGGGCCCCCTCCCCTCTCCCGG - Intronic
1161150038 19:2702710-2702732 GAGCGCTCGCTCCCCTCTGCGGG + Intergenic
1161577241 19:5061104-5061126 GGTGGCCCGCCCTGCTCTCCTGG - Intronic
1161670124 19:5602598-5602620 CAGGGCGCGCTCCCCTCTCTAGG + Intronic
1161953799 19:7482043-7482065 GTGGGCCCTCTCTCTGCTCCTGG - Exonic
1162591877 19:11597440-11597462 CAGGCCCTGCCCTCCTCTCCCGG - Exonic
1163804256 19:19386374-19386396 TAGGGGCCTCCCTCCTCTCCAGG + Intronic
1165202464 19:34156295-34156317 GAGGTCTCCCTCTCCTGTCCAGG - Intergenic
1166367701 19:42285695-42285717 CAGGGGCCTCTCTCCTCTGCTGG + Intronic
1167498224 19:49831348-49831370 GAAGGGCCGCTCACCCCTCCTGG - Exonic
1167664840 19:50818050-50818072 GAGGCCCCGCCCTCCTCCCGAGG - Intergenic
1202684755 1_KI270712v1_random:39034-39056 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
925093235 2:1172229-1172251 CAGGGCCTGCTCTCCACTCAGGG + Intronic
927963952 2:27257827-27257849 GAGAGCCAGCTCTCCCATCCTGG + Intronic
928130333 2:28644492-28644514 GAGTGCCCGCCTTCCTCTCAGGG + Intergenic
929772841 2:44907137-44907159 GGAGGGCTGCTCTCCTCTCCAGG + Intergenic
934210160 2:89968877-89968899 GAGGGCCCCCGCTCAGCTCCTGG + Intergenic
934246963 2:90315812-90315834 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
934262362 2:91486791-91486813 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
934305412 2:91817780-91817802 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
934327844 2:92034968-92034990 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
934466234 2:94265507-94265529 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
934503334 2:94875021-94875043 GACGGCCCCCTCTCATCACCTGG + Intronic
935680244 2:105629700-105629722 GAGGCCCTGCTTTCCTCTGCTGG + Intergenic
936484995 2:112918005-112918027 GAGCACCTGTTCTCCTCTCCTGG + Intronic
939985900 2:148829759-148829781 GAGAGCCCTGTCTCCTATCCTGG + Intergenic
942295903 2:174517006-174517028 GAGGACACTCTCTCCTCTTCTGG - Intergenic
946333077 2:219021367-219021389 CAGGGCCTGCTGTCCTCCCCTGG - Intronic
947617767 2:231569252-231569274 GGGAGCCAGCTCTCCTCCCCTGG - Intergenic
947634591 2:231673529-231673551 GAGGGCCCGCCCCCCACGCCAGG + Intergenic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
1170485018 20:16807243-16807265 GAGGGCCCCCTCCCGTCCCCTGG + Intergenic
1170948118 20:20910031-20910053 GGGCCCCCGCTCCCCTCTCCCGG - Intergenic
1171466996 20:25336791-25336813 CAGGCCCCGCTGTCCTCCCCGGG - Intronic
1172644432 20:36461241-36461263 GTGGGCGCGCGCTCCTTTCCTGG + Intronic
1174163524 20:48568455-48568477 GAGCCCCAGCTCTTCTCTCCTGG + Intergenic
1175217731 20:57400377-57400399 GGGGTCCCCCTGTCCTCTCCTGG + Intronic
1175769684 20:61615951-61615973 GGGGGCCCGCTCTGCTCTCTTGG - Intronic
1175808931 20:61847093-61847115 GAGGGCCAGCTCTGAGCTCCAGG - Intronic
1176159827 20:63642382-63642404 CAGCGCCCGCTCGCCTCACCTGG + Intronic
1176311497 21:5153179-5153201 GGGGGCCCGTTCACCTTTCCTGG + Intronic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1179129407 21:38621307-38621329 GAGAGCGCACTTTCCTCTCCAGG + Intronic
1179630751 21:42677023-42677045 CAGAGCCCGCTCTTCCCTCCTGG + Intronic
1179845553 21:44108856-44108878 GGGGGCCCGTTCACCTTTCCTGG - Intronic
1179955202 21:44734615-44734637 GAGGGGCCGCTCCCCACTTCGGG - Intergenic
1180590595 22:16933973-16933995 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1183061822 22:35340829-35340851 AAGGGCACTCTCTCCGCTCCTGG + Intronic
1183248170 22:36709943-36709965 CAGGGCCTGCTCTTCTCTCTCGG + Intergenic
1183309731 22:37102942-37102964 GAGGGCCCACTTTCCCCACCTGG + Intronic
1183373606 22:37449477-37449499 CAAGGCCCTCTCTGCTCTCCAGG + Intergenic
1183966200 22:41444449-41444471 GAGGGCCCGCTCTGCACTCTGGG + Intronic
1184791722 22:46704098-46704120 GGGTGCCTGCTGTCCTCTCCTGG + Intronic
950476188 3:13216366-13216388 GAGGGCCCCCTGTCCCCTGCTGG - Intergenic
952921239 3:38285248-38285270 CAGGGCCCCCTCCCCTCTGCTGG - Intronic
954409374 3:50363749-50363771 AAGTGCCCCCTCACCTCTCCAGG - Intronic
955052983 3:55430562-55430584 GAGGACCCTCACTCCTCCCCTGG + Intergenic
955406179 3:58627098-58627120 GAGGGCCCCCTGTCCTCTTGCGG + Exonic
961088527 3:124090565-124090587 GAGGGGCCTCTCTCCTCTCAAGG - Intronic
961365316 3:126395782-126395804 GAGGGTCCACTCTCACCTCCTGG - Intronic
962722439 3:138187998-138188020 GAGCGCCCACTCAGCTCTCCCGG + Intronic
967055684 3:185826309-185826331 GAAGGACCTCTTTCCTCTCCGGG - Intergenic
968134072 3:196209101-196209123 GAGGGCTGCCTCTCCTCCCCTGG + Intronic
968758181 4:2427486-2427508 GAGTGCCCGCTCCCTGCTCCTGG - Intronic
969154713 4:5200509-5200531 GTGGGCCTGCTCTACTGTCCTGG - Intronic
969414032 4:7047272-7047294 GAGGGCCAGTGCTCCTCTGCAGG + Intronic
972858073 4:43132247-43132269 GATGTACTGCTCTCCTCTCCAGG + Intergenic
973543257 4:51955348-51955370 GAAGACCCTCTTTCCTCTCCAGG - Intergenic
976039686 4:80868625-80868647 AAGGCCCTGCTCTCCTCTCTGGG + Intronic
976351890 4:84069371-84069393 TTGGGCATGCTCTCCTCTCCTGG + Intergenic
976765484 4:88593183-88593205 CCGGGCCGGCTCGCCTCTCCCGG + Intronic
983792321 4:171813361-171813383 GGCGGCCCGCCCTCCCCTCCTGG + Intronic
984782210 4:183536201-183536223 GAGGGCCCCAGCTCCTTTCCTGG - Intergenic
985374826 4:189323689-189323711 GATTGCCAGCTCTCCCCTCCAGG + Intergenic
987027203 5:13939582-13939604 CAGGGCCCCGTCTCCTTTCCCGG + Intronic
991411002 5:66345737-66345759 GAGGACCTACTCTACTCTCCAGG + Intergenic
992837428 5:80654673-80654695 GCGGGCTCGCGCTCCTCGCCAGG + Exonic
997434002 5:133860959-133860981 GAAGGCCACCTCTCCTCTCAAGG + Intergenic
998850384 5:146345752-146345774 GAACGCCCGCTGTCCTCGCCGGG + Intergenic
999768537 5:154757412-154757434 GCGCGCCCACTCTCCTCTCTCGG + Intronic
1001742577 5:174066091-174066113 GAGGGACCACACTCCTCCCCTGG - Intronic
1002861897 6:1086676-1086698 GAGGGGCAGCTCTCCTCTTGGGG + Intergenic
1003140634 6:3468567-3468589 GAGGGCCGGATCTCCTGCCCCGG - Intergenic
1003760462 6:9173530-9173552 GAGGGCCAGCTCTCCCTTACAGG - Intergenic
1004566585 6:16803712-16803734 GAGAGCCCGCTCTCCTCTGCAGG + Intergenic
1005848430 6:29800838-29800860 GAGGGCCCGCCCTGCACTCTGGG + Intergenic
1005926738 6:30451344-30451366 GAGGACCCGGTCTCTCCTCCAGG - Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006043013 6:31270905-31270927 GAGGGCCCCCTCTGCTCTCTAGG - Intronic
1006249879 6:32773972-32773994 AAGGGCCCACTCTACTCTTCTGG + Intergenic
1013638885 6:112054004-112054026 GGGGGCAGGCTCTGCTCTCCAGG + Intergenic
1017077937 6:150636566-150636588 GAAGGTCTGCTCTCCTGTCCAGG - Intronic
1017827187 6:158090501-158090523 AAGGGCACACTCTCCTCTCTAGG - Intronic
1019271272 7:150376-150398 GAGGGCCCGGAGTCCTCCCCAGG + Intergenic
1019524663 7:1475547-1475569 GAGGCCCAGCTCTCCCCACCAGG + Intronic
1019637478 7:2083808-2083830 GAGCGCCCGTTCCCATCTCCAGG + Intronic
1023864757 7:44233424-44233446 CCAGGACCGCTCTCCTCTCCTGG + Intronic
1024463032 7:49679626-49679648 GATGGGCAGCTATCCTCTCCTGG + Intergenic
1024512371 7:50213832-50213854 GAGGGGCTGAGCTCCTCTCCTGG + Intergenic
1024676114 7:51639102-51639124 TAGGGCCAGCTCTCCTCTCCAGG + Intergenic
1028271502 7:88796560-88796582 TATGGCCTTCTCTCCTCTCCTGG + Intronic
1031962009 7:127998666-127998688 GAGGGCCCTCTCTTCTCTCTAGG - Intronic
1031998263 7:128247005-128247027 TAGAGACCCCTCTCCTCTCCAGG + Intronic
1035202437 7:157276172-157276194 GAGGCCCCTCTCCTCTCTCCGGG + Intergenic
1040776091 8:51044794-51044816 CAGGCCCTGCTATCCTCTCCAGG + Intergenic
1041787556 8:61651573-61651595 GAGTGCCCTTTCTCCTCTCAGGG - Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1045877249 8:106996508-106996530 GAGGGCCCGATATTCTCTGCAGG - Intergenic
1048994377 8:139783978-139784000 GAGGCACCTCTCTCCTGTCCTGG - Intronic
1049236212 8:141513647-141513669 CAGGGGCCCCTCCCCTCTCCTGG - Intergenic
1049605022 8:143525360-143525382 GTGGGCGCGGTCTCCTCTTCAGG + Intronic
1049735494 8:144202723-144202745 GATGGCGGGCGCTCCTCTCCAGG - Intronic
1049735777 8:144203530-144203552 GAGAGCGGGCGCTCCTCTCCGGG - Intronic
1053425390 9:38006783-38006805 CAGGGCCCGTGCTCCTCTACTGG + Intronic
1053696283 9:40642279-40642301 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1054307534 9:63441507-63441529 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1054406262 9:64765509-64765531 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1054439889 9:65250982-65251004 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1054490517 9:65770957-65770979 GAGGGCCCCCACTCAGCTCCTGG + Intergenic
1054787181 9:69221095-69221117 GAGGTCCCGCTCCCGGCTCCGGG - Exonic
1055422485 9:76159102-76159124 GATGGCCAGGTCTCCTCTCCTGG - Exonic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1057756914 9:97846524-97846546 GAGGGCAAGCTCAGCTCTCCTGG + Intergenic
1058553447 9:106140206-106140228 GAGGGAGCACTCTCCTCTTCGGG + Intergenic
1061504609 9:131024884-131024906 GGAGGCCCCCTCTCCTGTCCTGG + Intronic
1062367418 9:136217679-136217701 GCAGACCTGCTCTCCTCTCCCGG - Intronic
1202778731 9_KI270717v1_random:15940-15962 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1203585807 Un_KI270747v1:2348-2370 GAGGGCCCCCACTCAGCTCCTGG - Intergenic
1186669841 X:11757868-11757890 GAGCGCCCGCTCTCCGGCCCGGG - Intergenic
1187396709 X:18925649-18925671 GTTGGCCTGCTCTCCTCACCTGG + Exonic
1188307170 X:28572397-28572419 CCTGGCCCCCTCTCCTCTCCAGG - Intergenic
1198806523 X:140500551-140500573 GAGGGTACTCTCTCCTCTGCCGG - Intergenic
1200107811 X:153724505-153724527 GAGCGCCGGCCCTCCGCTCCGGG - Intronic
1201194033 Y:11474208-11474230 GAGGGCCCCCACTCAGCTCCTGG - Intergenic