ID: 1178531307

View in Genome Browser
Species Human (GRCh38)
Location 21:33378571-33378593
Sequence CTGTCCTAATAGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178531307_1178531310 30 Left 1178531307 21:33378571-33378593 CCAGCTTCCTTCTATTAGGACAG No data
Right 1178531310 21:33378624-33378646 TAAAGAATAGCAATTTTGGCCGG No data
1178531307_1178531309 26 Left 1178531307 21:33378571-33378593 CCAGCTTCCTTCTATTAGGACAG No data
Right 1178531309 21:33378620-33378642 TTTTTAAAGAATAGCAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178531307 Original CRISPR CTGTCCTAATAGAAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr