ID: 1178533005

View in Genome Browser
Species Human (GRCh38)
Location 21:33390817-33390839
Sequence GTAGAAACCACACACAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178533005_1178533008 -6 Left 1178533005 21:33390817-33390839 CCTGTCCTGTGTGTGGTTTCTAC No data
Right 1178533008 21:33390834-33390856 TTCTACACACTTCTCAGAAAGGG No data
1178533005_1178533009 15 Left 1178533005 21:33390817-33390839 CCTGTCCTGTGTGTGGTTTCTAC No data
Right 1178533009 21:33390855-33390877 GGTGAAATAATGCTGCCTTCTGG No data
1178533005_1178533010 27 Left 1178533005 21:33390817-33390839 CCTGTCCTGTGTGTGGTTTCTAC No data
Right 1178533010 21:33390867-33390889 CTGCCTTCTGGCCGTTTTGCTGG No data
1178533005_1178533007 -7 Left 1178533005 21:33390817-33390839 CCTGTCCTGTGTGTGGTTTCTAC No data
Right 1178533007 21:33390833-33390855 TTTCTACACACTTCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178533005 Original CRISPR GTAGAAACCACACACAGGAC AGG (reversed) Intergenic
No off target data available for this crispr