ID: 1178533006

View in Genome Browser
Species Human (GRCh38)
Location 21:33390822-33390844
Sequence AGTGTGTAGAAACCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178533006_1178533009 10 Left 1178533006 21:33390822-33390844 CCTGTGTGTGGTTTCTACACACT No data
Right 1178533009 21:33390855-33390877 GGTGAAATAATGCTGCCTTCTGG No data
1178533006_1178533010 22 Left 1178533006 21:33390822-33390844 CCTGTGTGTGGTTTCTACACACT No data
Right 1178533010 21:33390867-33390889 CTGCCTTCTGGCCGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178533006 Original CRISPR AGTGTGTAGAAACCACACAC AGG (reversed) Intergenic
No off target data available for this crispr