ID: 1178535035

View in Genome Browser
Species Human (GRCh38)
Location 21:33403790-33403812
Sequence CCCCCACCTGGGGCACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 256}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178535035_1178535044 -4 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535044 21:33403809-33403831 GGGGTCTTGCGGGGTGCCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 227
1178535035_1178535045 3 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535045 21:33403816-33403838 TGCGGGGTGCCCAGGGCTAGAGG 0: 1
1: 0
2: 2
3: 29
4: 277
1178535035_1178535053 27 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535053 21:33403840-33403862 GCCCGCTGGGAGCCCGCAGCGGG 0: 1
1: 0
2: 2
3: 34
4: 578
1178535035_1178535043 -5 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535043 21:33403808-33403830 GGGGGTCTTGCGGGGTGCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 274
1178535035_1178535050 13 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535050 21:33403826-33403848 CCAGGGCTAGAGGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 30
4: 269
1178535035_1178535047 5 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535047 21:33403818-33403840 CGGGGTGCCCAGGGCTAGAGGGG 0: 1
1: 0
2: 3
3: 18
4: 230
1178535035_1178535051 14 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535051 21:33403827-33403849 CAGGGCTAGAGGGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1178535035_1178535052 26 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535052 21:33403839-33403861 GGCCCGCTGGGAGCCCGCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 235
1178535035_1178535046 4 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535046 21:33403817-33403839 GCGGGGTGCCCAGGGCTAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 183
1178535035_1178535055 28 Left 1178535035 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1178535055 21:33403841-33403863 CCCGCTGGGAGCCCGCAGCGGGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178535035 Original CRISPR CCCCCACCTGGGGCACCCGC AGG (reversed) Intronic
900165856 1:1244049-1244071 CCGCCCCCTGGGGCAGCAGCGGG + Exonic
900525979 1:3128886-3128908 CCCCCACCTGGGGCCAGGGCAGG - Intronic
900989210 1:6090367-6090389 CCCCCACCTGGTCCTCCCCCAGG + Exonic
901628935 1:10638914-10638936 CCGCCGCCAGGGCCACCCGCGGG + Exonic
901878457 1:12180444-12180466 CCCCCACCTCGGGTACTTGCAGG + Intronic
902656113 1:17869477-17869499 CCCCCACCTGCGGCTCCCTGTGG - Intergenic
903583758 1:24392499-24392521 CTCCCTCCTGTGGCACCAGCTGG + Intronic
904559294 1:31385987-31386009 CCCTCACCTGGGCCAGCTGCAGG - Intergenic
904642372 1:31939998-31940020 CCCCCTCCTGGGCCACCTGGTGG - Intronic
910371664 1:86523486-86523508 CCCCAACCTGTTGCAGCCGCTGG + Intergenic
912968733 1:114260525-114260547 TCCCCACCTGGGTGACCTGCAGG + Intergenic
915327386 1:155087281-155087303 CCCACACCTGGGGGACCCCCTGG + Exonic
915754615 1:158248051-158248073 CCCCCACATGGGACACCTGTTGG - Intergenic
917080333 1:171251587-171251609 GCCTCACATGGGGCACCAGCTGG + Intronic
917979574 1:180260611-180260633 CCCACACCTGGGCCAGCCGGAGG + Intronic
920039353 1:203085601-203085623 TCTCCACCTTGGGCAGCCGCTGG + Exonic
921010325 1:211134253-211134275 CCCCCAGCTTGGTCTCCCGCAGG - Intergenic
922885956 1:229020655-229020677 CCTCCACTTGGGCCACCCACTGG + Intergenic
924707436 1:246511395-246511417 CCCCCTCCTGAGTCACCCTCTGG - Intergenic
1064418071 10:15168160-15168182 CGCCCACCGGAGCCACCCGCGGG + Intronic
1066109371 10:32182650-32182672 CACCCACCCGGGGCAGCAGCTGG - Intergenic
1066597064 10:37062512-37062534 CGCCCACCTGGAACTCCCGCTGG - Intergenic
1067079611 10:43205675-43205697 CTCCTACCTGGGGCAGCAGCAGG + Intronic
1067296951 10:44980055-44980077 CCCCCACCTGCAGCACAGGCAGG - Intronic
1067684827 10:48459817-48459839 CCCCCGCCTGGCGCCCCTGCTGG - Exonic
1071468165 10:85959538-85959560 CCCCCACCCGAGGCAACCACTGG + Intronic
1073578733 10:104644950-104644972 CAACCACCTGGGGCACACACTGG - Intronic
1074536086 10:114329463-114329485 GCCCCACCAGGGGCAGCTGCTGG - Intronic
1075315177 10:121447547-121447569 CCCTCACCTGGGGCATCGGGAGG + Intergenic
1075617594 10:123902979-123903001 CCACCACCTGGAGTACCCTCTGG + Intronic
1075810141 10:125219122-125219144 CCCTCTCCTTGGTCACCCGCTGG + Intergenic
1076690741 10:132222833-132222855 CCCCCACCTGAGCCGCCCACAGG + Intronic
1076847446 10:133076239-133076261 CCCCCACCTTGGGCACCCTCAGG + Intronic
1077182277 11:1222192-1222214 CTCCCACCTGGGGCAGGCGGAGG + Intergenic
1077200458 11:1304484-1304506 CCTCCCCTTGGGGCTCCCGCAGG - Intronic
1077242428 11:1517601-1517623 CCCCCACCTCTGGCTCCCCCAGG + Intergenic
1077250241 11:1557620-1557642 TGCCCACCTGACGCACCCGCTGG + Intronic
1077422625 11:2460168-2460190 CCCCCAGCTGGGCCACAGGCTGG - Intronic
1079126210 11:17720205-17720227 TCTCCACCTTGGGCAACCGCTGG - Exonic
1079132665 11:17756721-17756743 CCCCCAACTGGGCCATCAGCAGG - Intronic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1081712664 11:45227331-45227353 CATCCACCTGGGACACCAGCAGG - Intronic
1083675725 11:64323660-64323682 CCCCCACCTGGGACCCCTGAAGG - Intergenic
1084177960 11:67433269-67433291 CCCCCTCCTGGGGCAAGGGCAGG + Intronic
1090188996 11:124756312-124756334 CCCCCACATGGGGCACACCCTGG + Exonic
1090204576 11:124877370-124877392 CCTCCACCTGGGGCGTCAGCGGG - Intronic
1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG + Intronic
1096148970 12:49296921-49296943 CCTCCACCTGCTGCACCTGCTGG - Exonic
1096214572 12:49792158-49792180 ACCCCACCTTGGGCCCCCTCTGG - Intronic
1096241288 12:49961668-49961690 CCCCCGGCCGGGGCAGCCGCCGG - Intergenic
1096529381 12:52233548-52233570 TCTCCTCCTGGCGCACCCGCTGG - Exonic
1098640970 12:72838503-72838525 GCCCCACCTGGGGGACTCACAGG - Intergenic
1103703808 12:122860936-122860958 CCCCCACCTGAGCCGCCTGCAGG + Exonic
1103936937 12:124481935-124481957 CCCACACCTGAGGCAACCCCCGG - Intronic
1104607691 12:130202137-130202159 CCCACACCTGGGACACATGCTGG - Intergenic
1104720016 12:131040037-131040059 ACCCCACCAGCGGCACCCTCAGG + Intronic
1104801440 12:131557452-131557474 ACCCCTCCTGGGGCACATGCTGG - Intergenic
1104930963 12:132339295-132339317 GCCCCACCTGGGCCAGCCTCCGG + Intergenic
1105293787 13:19071352-19071374 CCCACCCCTGGGCCACCTGCTGG + Intergenic
1110751421 13:79119936-79119958 CACCCACCTGGAACTCCCGCTGG + Intergenic
1113711340 13:112467286-112467308 TCCCCACCTGGGGCTCCTGGGGG - Intergenic
1113950171 13:114067099-114067121 CCCCCAGCTGGGGCACTCTGGGG + Intronic
1113950209 13:114067203-114067225 CCCCCACCTGGGGCACTTCTGGG + Intronic
1113950239 13:114067273-114067295 CCCCCACCTGGGGTACTCTGGGG + Intronic
1114549640 14:23525515-23525537 CCCCCACCTGAGGCCCTCGGGGG - Exonic
1114665356 14:24374339-24374361 CCTCCACCTGGGGCAGCTCCTGG - Exonic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1117546665 14:56798635-56798657 CCCCCAGCTGGGGCAGACGCCGG - Intergenic
1118787131 14:69055224-69055246 CTTCCACCTGGGGCCCCTGCGGG - Exonic
1119428541 14:74551264-74551286 CCCGCACCTGGGCCACCTGGTGG + Exonic
1120632233 14:86905374-86905396 CCTCCACCTGGGGCCCCAGTGGG - Intergenic
1121711107 14:96039667-96039689 CCCCCACTTGGTGCACGCGTCGG + Intronic
1122159018 14:99769349-99769371 CCCTCACCGTGGGCACCAGCAGG + Intronic
1122781712 14:104146561-104146583 CCACCACGTGGGGCAGCAGCAGG - Intronic
1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG + Intronic
1122938264 14:104969911-104969933 AGCCCACCTCGGGCACCCCCAGG + Intronic
1123919352 15:25059697-25059719 CCACCACCCAGGGCATCCGCAGG + Intergenic
1125760684 15:42093809-42093831 CCACCACCTGGGGCACCGGGGGG + Intronic
1127545837 15:59993961-59993983 CCACCACCTGGGCCACCCTCAGG - Intergenic
1127916414 15:63459111-63459133 CGCCCACCCGGAACACCCGCTGG - Intergenic
1127973057 15:63977321-63977343 CCCCCACCTTGGGCAGGTGCTGG + Intronic
1129425672 15:75460868-75460890 CCCCAACCTGGGTCACTGGCCGG - Intergenic
1131405859 15:92163847-92163869 CCCCCACCTGGCTCCCCCTCAGG - Exonic
1132196566 15:99918305-99918327 CCCCCACCCTGGGCACCAGAAGG + Intergenic
1132583362 16:695172-695194 GCCCCACCCGGAGCAGCCGCTGG + Intronic
1132648880 16:1011569-1011591 CCCTCACCTGGGGCTTCCGGAGG + Intergenic
1132737656 16:1394839-1394861 CCACCACGTCGGGCACCCGGTGG + Intronic
1133320237 16:4909141-4909163 CCCACTCCTGGGGCCCCTGCAGG + Intronic
1134069885 16:11254631-11254653 CCCCCTCCTGGTGCTCCCTCTGG - Exonic
1136515875 16:30768138-30768160 CCCCAACCTGGGCCACCCAGAGG + Exonic
1139023320 16:62780311-62780333 CCACCCCCTGGGGCCCCCTCAGG + Intergenic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1141760627 16:86026412-86026434 GCCCTGCCTGGGGCACCAGCGGG + Intergenic
1142023887 16:87801971-87801993 CCCCCACCTGGGTGCCCTGCAGG + Intergenic
1142291053 16:89193699-89193721 CCTCCACCAGGGCCACCCGAGGG + Intronic
1142509694 17:385894-385916 CCCCGACCTCGGGGACCCTCGGG - Intronic
1142671038 17:1487504-1487526 CCCCGAGCGGGGGCACCAGCTGG + Intronic
1142748463 17:1972954-1972976 CCCCCACCTGCTGCTCCAGCGGG + Intronic
1143115779 17:4581257-4581279 CCCACACCTGGGGCAGCAGCTGG - Intergenic
1143705634 17:8696125-8696147 CCCCAACCTGGGGCATTCTCCGG - Intergenic
1143792298 17:9307362-9307384 CCCCCACATGGGGCAACACCTGG + Intronic
1144658019 17:17050519-17050541 CCACCACCTGTGGCACCCCAGGG - Intronic
1147840641 17:43369056-43369078 CCCCCTCCTGGGTCACCTCCTGG - Intergenic
1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG + Intergenic
1152782289 17:82231709-82231731 GCCCCACTTGGGGCACCAGTGGG + Intronic
1154133005 18:11752017-11752039 CCGCCCCCTCGGGGACCCGCTGG + Intronic
1157667378 18:49499203-49499225 CCCCAACGTGGGGCAGCTGCGGG - Intergenic
1159656134 18:71031654-71031676 CCCCCACCTGGAACTCCAGCTGG + Intergenic
1160385255 18:78492951-78492973 CCCACGCCTGGGGCAGCTGCAGG + Intergenic
1160655671 19:267510-267532 GCCCAACCTGGAGCACGCGCGGG - Intergenic
1160798227 19:955374-955396 CCAGCAGCTGGGGCCCCCGCAGG + Intronic
1160833388 19:1113528-1113550 CACCCACCTCCGCCACCCGCTGG + Exonic
1160923923 19:1533943-1533965 CCCACACCTGTGCCACCTGCTGG + Exonic
1160990640 19:1858983-1859005 CCACTAGCTGGGGCACCTGCAGG + Intronic
1161208888 19:3056227-3056249 GCCCCGCCTTGGGCACCCCCAGG - Intronic
1161449815 19:4338788-4338810 GGCCCAGCTGGGGCACCCACTGG - Exonic
1161487106 19:4542538-4542560 CCCCCACCCGTGCCACCCCCAGG + Intergenic
1161840132 19:6675064-6675086 CCCCTCCCTGGGGCTCCAGCCGG + Intergenic
1161931834 19:7345762-7345784 CCCCCAGCTGGAGCTCCTGCAGG + Intergenic
1162349514 19:10140158-10140180 CTCCCTTCTGGGGCAGCCGCTGG + Exonic
1162535733 19:11262194-11262216 CTCCCATCTGGGACCCCCGCCGG + Intronic
1163552648 19:17974158-17974180 CCACCGCCTGGGCCACCGGCGGG + Exonic
1163636068 19:18437700-18437722 CCCCGAGCCGGGGCACCTGCCGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166678592 19:44754292-44754314 CTCCCGCCTGGGGGACCCTCTGG - Intronic
1167293281 19:48635891-48635913 GCCCCAGCCGGGGCATCCGCCGG + Exonic
1167448734 19:49554957-49554979 CCCCCACCTGTGGCAGCCTGAGG - Intergenic
925912650 2:8583549-8583571 CCCCAACCCCGGGCACCCCCCGG + Intergenic
926581267 2:14634195-14634217 CCACCACCTGCTGCACCAGCTGG + Exonic
927156629 2:20224716-20224738 CCCCCTCCACGTGCACCCGCCGG + Intronic
927872573 2:26632975-26632997 CCCCCACCACGGGCACCACCGGG + Intronic
927888172 2:26731075-26731097 CCCCCACCCCGGGCAGCCCCCGG + Exonic
932423085 2:71612791-71612813 CCCCTACCTGGGCCACCCTGTGG - Exonic
935173962 2:100631690-100631712 TCCCCACCTGGCCCACCAGCAGG + Intergenic
935592471 2:104855360-104855382 CCCCCGCCCCGGGCCCCCGCCGG - Intergenic
937100367 2:119263868-119263890 CCTCCACCTGGGGCAGCAGCAGG + Exonic
938305746 2:130253046-130253068 CCCGCTCCTCGGGCGCCCGCAGG - Intergenic
938427400 2:131202975-131202997 CCCCTACATGGGGAACCCTCAGG - Intronic
938468344 2:131537023-131537045 CCCCTACATGGGGAACCCTCGGG - Intergenic
947624067 2:231608441-231608463 CTCCTACCTGGGGCACCTGTGGG + Intergenic
948017140 2:234700013-234700035 GCCCCACCTGGTGCACTCCCAGG + Intergenic
948237568 2:236402061-236402083 CAGCCACCTGGGGCACGCACTGG - Intronic
948467216 2:238158339-238158361 TCCCCACCTGTCGCACCTGCCGG - Intergenic
948709577 2:239817462-239817484 CAGCCACCTCGGGCACCAGCTGG - Intergenic
948760465 2:240187215-240187237 CCCCCACCTTGGGCATACCCTGG - Intergenic
948790940 2:240376521-240376543 GCCCCACCTGGGACCCCCGTGGG + Intergenic
948874016 2:240817996-240818018 GCCCCATCTGGGGCTCCAGCCGG - Intronic
1168764700 20:373745-373767 GCCGCCCCTGGGGCAACCGCCGG + Intronic
1171878382 20:30598749-30598771 CCCACCCCTGGGACACCCACTGG + Intergenic
1172178820 20:32988324-32988346 CCTCCAACTCGGGCACCCCCAGG - Intronic
1172425287 20:34851696-34851718 CCGCCATCTGGGGCCCCAGCAGG - Intronic
1172771378 20:37384431-37384453 CGCCCACCTGGGGCCACGGCGGG + Intronic
1172774901 20:37401642-37401664 CCACCAGCTGAGGCAGCCGCAGG - Exonic
1173250414 20:41361477-41361499 CCTCCACTTGTGCCACCCGCTGG + Exonic
1174587165 20:51618329-51618351 AAGCCACCTGGGGCACCCACTGG + Intronic
1175564548 20:59962725-59962747 CCACCACCTCGGGAACCCACAGG - Intronic
1175780627 20:61680024-61680046 CCACAGCCTGGGGCACCCGGCGG + Intronic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1175955163 20:62605378-62605400 CTCTGACCTGGGGCACCGGCTGG - Intergenic
1176045935 20:63092567-63092589 GCCCCACGTGGGGCAGCAGCCGG - Intergenic
1176120097 20:63450417-63450439 CCCACACCTGGGGCAGCCCCAGG - Intronic
1176217543 20:63955550-63955572 CCCCTTCCTGGGGACCCCGCGGG + Intronic
1176516691 21:7789550-7789572 CACCCTCCTGGGGCTCCTGCTGG - Intergenic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1178650719 21:34419562-34419584 CACCCTCCTGGGGCTCCTGCTGG - Exonic
1179545084 21:42108265-42108287 CCCCAACCCGGAGCACCCCCAGG + Intronic
1179981543 21:44898378-44898400 CTCCCACCTCGGGCAGCGGCTGG + Intronic
1180195084 21:46189314-46189336 CCCCCACGTGGGGTAGCAGCAGG - Exonic
1181017632 22:20080368-20080390 CACCTACCTGAGGCGCCCGCGGG - Exonic
1181051905 22:20241888-20241910 TCCCCACCTCGGGCCCTCGCCGG - Exonic
1182143623 22:27983392-27983414 CCCCAACCTGGGACAGCCGGAGG - Exonic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1184095826 22:42315754-42315776 CCTCCACCTGGGGCTACCTCTGG - Intronic
1184222844 22:43111495-43111517 CCCCCTCGCGGGTCACCCGCAGG - Intronic
1184368514 22:44068037-44068059 GCCCCGCCTGGAGCACCTGCTGG + Intronic
1184682734 22:46080569-46080591 CCCCCACCCGGGTGACCGGCTGG + Intronic
1185055077 22:48575292-48575314 CCCCCGCCTGGCGCGCCGGCGGG - Intronic
1185212144 22:49576329-49576351 CTCCCCCCTGGGGCTCCCACAGG - Intronic
1185227311 22:49660419-49660441 CCTCTTCCTGGGGCACCCCCAGG - Intergenic
1185244885 22:49768285-49768307 CCCCCACCTGGCTCGCCCGTGGG + Intergenic
949980440 3:9499288-9499310 GCCTCACCTGGGGCCCCCACTGG + Exonic
950228906 3:11259112-11259134 CCACCACCAGGGGCATCAGCTGG - Exonic
950282403 3:11719459-11719481 CCCGCCCCTGGGTCCCCCGCAGG - Intronic
950407338 3:12813003-12813025 CCTCCACCAGGGGCACCAGGCGG - Exonic
950421304 3:12901276-12901298 CCACCACCTGGGGCCCCCAGAGG - Intronic
950538393 3:13594996-13595018 CACCCAGCCGGGGCAGCCGCAGG - Intronic
950633621 3:14299830-14299852 CACCAACATGGGGCACCAGCAGG + Intergenic
953880484 3:46688782-46688804 CTCCCACCTAGGGCACCTGATGG - Intronic
954323447 3:49847772-49847794 CCCCAACTTGGGGTACCTGCAGG - Intronic
954408432 3:50358568-50358590 CGCGCACCTGGGGCACTCGCAGG + Exonic
954617224 3:51975228-51975250 CCCTCCCCTGGGCCACCGGCCGG - Intronic
954745706 3:52786443-52786465 TGCCCACCTGGGGCAGCTGCAGG - Intronic
960873619 3:122275472-122275494 GCCCCTCCTGGGGCACCACCAGG + Intronic
961649399 3:128409970-128409992 CCCTCCCCTGGGGGACCAGCAGG - Intergenic
962023834 3:131527042-131527064 CCCCCAGCTCGGCCACGCGCCGG - Intergenic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
969213944 4:5708475-5708497 CACCCACGTGGGGCGCCCCCGGG + Exonic
983534120 4:168839321-168839343 CCCCCAACAGGGGCACCATCTGG - Intronic
985619112 5:944389-944411 CCCCCACCTGGGCAACCCCAGGG + Intergenic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
985875555 5:2591422-2591444 CTCCTACCTGGGGCAGCCCCTGG - Intergenic
987091187 5:14509076-14509098 CCACCACCTGGGGCTTCCTCTGG + Exonic
987370462 5:17188108-17188130 CCCCCACCTGTGGCACACAGAGG + Intronic
990457873 5:56005463-56005485 CCCCCACATTAGGCACCTGCAGG + Intergenic
990500294 5:56389906-56389928 CCCAGACCTGGGGGACCTGCTGG - Intergenic
992781524 5:80132493-80132515 CCCCAACCTGGAGCACCTCCTGG + Intronic
993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG + Intergenic
998131603 5:139654099-139654121 CCCTCACCTGGGGCTCCTACAGG + Intronic
999324841 5:150637573-150637595 ACCCCGTCTGGGGAACCCGCAGG + Intronic
1000701609 5:164457947-164457969 CCCCCACCTGTGACTCCAGCAGG + Intergenic
1002315790 5:178342219-178342241 CTCCCACCTGGAGCTCCAGCAGG + Intronic
1005994752 6:30924386-30924408 CCGCCCCCTGGGGCCCCCTCAGG + Exonic
1006377999 6:33682464-33682486 CCCCCACCCTGGGCAACCCCAGG - Intronic
1006408815 6:33860239-33860261 CCCCACCCTGGAGCCCCCGCAGG + Intergenic
1007343585 6:41209592-41209614 CACTCACCTGTGGCACCTGCAGG + Intergenic
1012393493 6:98769730-98769752 CCCCCACCTGGGGGAGCTCCAGG + Intergenic
1012818722 6:104057798-104057820 CCCCCAACTGGGGCCTCCCCAGG - Intergenic
1014304871 6:119727780-119727802 CCCCCACCTGTGGAATCTGCTGG + Intergenic
1015983104 6:138858632-138858654 CCCCAACCTGAGGCAGCCACTGG + Intronic
1017722562 6:157253977-157253999 CTCCCTCCTGGGGAACTCGCAGG - Intergenic
1017929528 6:158939705-158939727 CTCCCACCTGGGTCAGCCTCCGG + Intergenic
1018899501 6:168044111-168044133 CCCTCACCTGGGGAAGCTGCAGG - Intronic
1019153311 6:170023306-170023328 GCCCCACCTAGGGCGGCCGCCGG - Intergenic
1019278149 7:186891-186913 CCCCCACCTGGACCCTCCGCTGG + Intergenic
1019477973 7:1253063-1253085 ACCCCACCTTGGGGACCCCCAGG - Intergenic
1019599666 7:1874941-1874963 CCCCCACCCCGGGCCCCGGCTGG + Intronic
1019613402 7:1948115-1948137 GCCTCATCTGGGGCACCTGCAGG + Intronic
1019736010 7:2650014-2650036 CCCAACCCTGGGGAACCCGCTGG - Intronic
1019738510 7:2661801-2661823 CTTCCACCTGGGCCACCCACCGG + Exonic
1020283692 7:6664244-6664266 CCCACACCCGCCGCACCCGCCGG - Intergenic
1020796893 7:12687159-12687181 ATCCCACCTGGCGCGCCCGCCGG - Intronic
1023187826 7:37549886-37549908 CCGAAACCTCGGGCACCCGCAGG + Intergenic
1028762350 7:94509947-94509969 CCGCCACCTGCGCCTCCCGCCGG - Exonic
1033232968 7:139616085-139616107 CCCCCAGCAGGGACACCCACAGG - Intronic
1035018611 7:155787562-155787584 CCCCCGCCTGGCACACACGCTGG + Intergenic
1036660151 8:10702568-10702590 CACCCACCTGAGGCAGCAGCAGG + Intronic
1037879684 8:22566582-22566604 CCCCCACCTAGGGCAGGCACTGG - Intronic
1039424711 8:37476496-37476518 TCCCCAGCTGGGGCACCTGGTGG + Intergenic
1047523775 8:125615527-125615549 GCCCTGCCAGGGGCACCCGCGGG + Intergenic
1049190733 8:141285974-141285996 CCCCCACCCCAGGCAACCGCAGG - Intronic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049352595 8:142172054-142172076 TACCCAGCTGGGGCACCCACAGG + Intergenic
1051591201 9:18777775-18777797 CACCCACCTGGGGCAGACGGTGG + Exonic
1052896337 9:33750957-33750979 AGCCCACCTGGGGCCCCCTCCGG + Intronic
1053368768 9:37543059-37543081 TCCCCACGTGGGGCAGCCCCAGG + Intronic
1056538380 9:87551024-87551046 CCCCCACCTTGGCCAGCAGCCGG + Intronic
1056746958 9:89311383-89311405 CCCTCAGCCGGGGCCCCCGCGGG + Intronic
1059405874 9:114098219-114098241 CCCCCACCCCGGGTAGCCGCCGG - Intronic
1060599577 9:124869117-124869139 CGCCCACTTCCGGCACCCGCCGG - Exonic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1061191054 9:129082999-129083021 CCCCCACCTGGGACGCTCTCTGG - Intronic
1061191475 9:129085129-129085151 CCCCAACCTGGGGGAACCTCAGG - Intronic
1061389521 9:130309805-130309827 CCCCAACCTTGTGCAGCCGCAGG + Intronic
1062235645 9:135506425-135506447 CCACCATCTGGGACACCAGCTGG - Intergenic
1062385348 9:136307156-136307178 CCTCCACCTGGGTCACCCCTGGG - Intergenic
1062385565 9:136309648-136309670 CCCGCACCTGGGTCAGCCCCTGG - Intergenic
1062390615 9:136332255-136332277 CACCCACCTGGTGCAGCTGCAGG + Intronic
1185468217 X:368280-368302 CACCCACCTTGGGCACCGACGGG + Intronic
1185468315 X:368503-368525 CACCCACCTTGGGCACCGACGGG + Intronic
1185468417 X:368725-368747 CACCCACCTTGGGCACCGACGGG + Intronic
1185468463 X:368836-368858 CACCCACCTTGGGCACCGACCGG + Intronic
1186461495 X:9751956-9751978 CCCCCAGCAGGGGCACAGGCTGG - Intronic
1186511396 X:10132501-10132523 CCCCCACCAAAGGGACCCGCTGG - Intronic
1190708406 X:53048914-53048936 CCCCAACCTGGGGCTCTCCCAGG + Intergenic
1190745967 X:53321655-53321677 CCCCAACCTGGCGAACCCGAGGG - Intergenic
1191257652 X:58286582-58286604 CACCCACCTGGGTCATGCGCAGG + Intergenic
1199769428 X:150964916-150964938 ACCACACCTGGTGCACCCCCAGG - Intergenic
1200120203 X:153786559-153786581 CCCCAACCCCTGGCACCCGCTGG - Intronic
1200143052 X:153911159-153911181 CCACCACCAGGGGCACAGGCTGG + Exonic