ID: 1178535550

View in Genome Browser
Species Human (GRCh38)
Location 21:33407454-33407476
Sequence GGTAATGTATATAAAGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 1, 2: 27, 3: 124, 4: 516}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178535550_1178535552 12 Left 1178535550 21:33407454-33407476 CCAAGTGCTTTATATACATTACC 0: 1
1: 1
2: 27
3: 124
4: 516
Right 1178535552 21:33407489-33407511 CTCAGCCATTCTTTCGAACTAGG 0: 1
1: 0
2: 0
3: 12
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178535550 Original CRISPR GGTAATGTATATAAAGCACT TGG (reversed) Intronic
900761601 1:4475745-4475767 GCTAATGTGTATTAAGTACTTGG + Intergenic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
902306166 1:15541112-15541134 TATAATGTATATAAAGCTCTAGG + Intronic
902438598 1:16414544-16414566 GATAATGTAAATAATGCACTTGG + Intronic
902640888 1:17765417-17765439 GTTAATGTGTAAAAAGCACAGGG - Intronic
902806216 1:18862855-18862877 GATAATGTATATAAAATGCTTGG - Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
903551372 1:24159246-24159268 GGTCATGTATGTGAAGCACTCGG - Intronic
904034932 1:27553574-27553596 GATAATCTATATAAAGTGCTTGG - Intronic
904213787 1:28903699-28903721 CATATTGTATATAAAACACTTGG + Intronic
904273183 1:29363618-29363640 GTTAATATGTGTAAAGCACTTGG - Intergenic
904791470 1:33025263-33025285 GATCATGTATATAATGCACTTGG + Intronic
904877664 1:33669021-33669043 AGCAATGTACATAAAGCAGTTGG - Intronic
905400035 1:37694621-37694643 GTTAATGTATGTAAAACACTTGG - Intronic
905602501 1:39265868-39265890 GATAATGTCCATAAAGTACTTGG - Intronic
905968996 1:42126553-42126575 GTTAAAGTATATACAGAACTTGG + Intergenic
906496008 1:46304362-46304384 ATTAGTGCATATAAAGCACTTGG - Intronic
906542311 1:46596707-46596729 GCTAATGTATATAGAGCTCGTGG + Intronic
906802860 1:48752630-48752652 GAAAATGTGTATATAGCACTTGG - Intronic
906823582 1:48954913-48954935 GATAATGTATATATAGCATATGG + Intronic
907549377 1:55291449-55291471 GATAATGAATATAAAGCATGTGG + Intergenic
907549626 1:55293345-55293367 TGAAATGTTTATTAAGCACTGGG - Intergenic
907640714 1:56187268-56187290 GGTAATGTATTTTAATCACTGGG - Intergenic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
908053129 1:60254796-60254818 AGTAATGTATGTCAAACACTGGG - Intergenic
908059481 1:60331828-60331850 GATAATGCATATGAAGCACTTGG + Intergenic
908160025 1:61397605-61397627 GACAATGTATATAAGGCACACGG - Intronic
908564502 1:65340678-65340700 GATAATCTATATGAAGCATTTGG + Intronic
908593986 1:65666224-65666246 GATAATGTATTCAAAGTACTGGG - Intergenic
909154179 1:72049887-72049909 GGTAATGCATATCAGGCTCTGGG + Intronic
909474001 1:76062006-76062028 AGTAATGTAGATAAAACAATAGG - Intergenic
909538298 1:76762968-76762990 GCTTATGCATATAAAGCATTTGG + Intergenic
909743552 1:79064413-79064435 GGTAAAGGGTATAAATCACTTGG - Intergenic
910245859 1:85137183-85137205 GACAATGTATATAAAGCACCTGG + Intergenic
912134542 1:106644385-106644407 GATAATCTAGATAAAGCACTTGG - Intergenic
912179135 1:107196380-107196402 TATAATGTATATAAACTACTTGG + Intronic
912339897 1:108903157-108903179 GGAAATGCATACACAGCACTAGG + Exonic
912626580 1:111209806-111209828 GCTAATATATCTAAAGCGCTTGG + Intronic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
913181180 1:116323340-116323362 GGGAATGTAAATAAAAGACTTGG + Intergenic
913298621 1:117346584-117346606 GGTAATGAGTCAAAAGCACTGGG - Intergenic
913313240 1:117525126-117525148 GGTAATACAAATAGAGCACTTGG - Exonic
913460255 1:119077975-119077997 ATTAATATATGTAAAGCACTGGG - Intronic
913700810 1:121372785-121372807 GGTAATGTACGTAAAGCCCATGG + Intronic
914041360 1:144053247-144053269 GGTAATGTACGTAAAGCCCATGG + Intergenic
914136725 1:144907239-144907261 GGTAATGTACGTAAAGCCCATGG - Intronic
914317277 1:146525207-146525229 GAAAATGCATGTAAAGCACTTGG + Intergenic
914497079 1:148208153-148208175 GAAAATGCATGTAAAGCACTTGG - Intergenic
914902475 1:151718234-151718256 GTTAGTAAATATAAAGCACTTGG - Intronic
915746382 1:158162508-158162530 GATAATGTGTATAAATCACCTGG - Intergenic
915937930 1:160099611-160099633 GGTAATGTACATAAAGTGTTTGG + Intergenic
916228499 1:162515233-162515255 AATAATATATATAAAGTACTAGG - Intronic
917123689 1:171666818-171666840 ATTAATGTCAATAAAGCACTTGG - Intergenic
917747843 1:178027793-178027815 GACACTGTATACAAAGCACTTGG + Intergenic
917870211 1:179234787-179234809 GGTAACATTTATACAGCACTTGG - Intergenic
917941253 1:179924148-179924170 GTTAATATACATAAAGCACTTGG - Intronic
918418947 1:184342378-184342400 GATAATGCATCTAAAGAACTTGG - Intergenic
919419252 1:197350878-197350900 AGTAATGTATATAAAACTCCTGG + Intronic
919701078 1:200631612-200631634 GTTAATGAATATAAACCAGTTGG + Intronic
920061113 1:203227622-203227644 GTTAATATATGTAAAACACTCGG + Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920488229 1:206391518-206391540 GGTAATGTACGTAAAGCCCATGG + Intronic
920600043 1:207315342-207315364 AATAATGTATGTAAAGCATTTGG - Intergenic
920965728 1:210699175-210699197 CATAATGTACATAAAGCACATGG + Intronic
921778372 1:219129809-219129831 GGTAAAGTATATAGAGCAGCAGG - Intergenic
921829991 1:219717193-219717215 GGAAATGTATATAAAGCAAAAGG + Intronic
923552380 1:234974202-234974224 GGTAATGTATTTAACACACATGG - Intergenic
924126009 1:240852535-240852557 GGTAATTTATATAAAGTACCAGG + Intronic
924391492 1:243565119-243565141 TGAAATGTATATCAAGCATTTGG - Intronic
1063642909 10:7849109-7849131 GTTAATGTGTGTGAAGCACTTGG - Intronic
1063862879 10:10331196-10331218 ATAAATGTATATAAAGCACTGGG - Intergenic
1063944217 10:11161597-11161619 AGTATTGTATATCAAGTACTTGG + Intronic
1063989154 10:11541364-11541386 GGTAATATACATAAAGCATTTGG - Intronic
1064591121 10:16891689-16891711 GGTAATGAATATACAAAACTTGG + Intronic
1064782937 10:18862801-18862823 GGTATTGTATTTCAAGAACTAGG + Intergenic
1066291893 10:34022018-34022040 AGTAATGTATCTAATGCCCTGGG + Intergenic
1067340282 10:45395737-45395759 GGTCATGCACATAAAGCACTCGG + Intronic
1067460353 10:46453636-46453658 GGCAATGTATATAAAGCATCTGG + Intergenic
1067626837 10:47930967-47930989 GGCAATGTATATAAAGCATCTGG - Intergenic
1068499936 10:57832315-57832337 GATAATGTGTGTAAAGCATTTGG - Intergenic
1068527907 10:58151976-58151998 GGTACTGGGCATAAAGCACTAGG - Intergenic
1068548613 10:58381112-58381134 GATAATGTATGTAAAATACTTGG + Intergenic
1068615075 10:59105319-59105341 AATAATGTATGTAAAGCATTTGG + Intergenic
1068971734 10:62965707-62965729 AGTAATGTATTTTCAGCACTTGG - Intergenic
1069344973 10:67458070-67458092 CATAATGTATATAAAGCAGTTGG + Intronic
1069594560 10:69662381-69662403 GGAAATGTACATAAAGTACCTGG - Intergenic
1069620488 10:69834523-69834545 GATATTGTATTTAAAGCACAAGG - Intronic
1069621234 10:69838470-69838492 GGAGATGTATGTAAAGCACGTGG + Intronic
1069859942 10:71464244-71464266 AATAATGTATATAAAGCACCTGG - Intronic
1070010490 10:72469122-72469144 TGTAATGTATATAAAGTGCCTGG + Intronic
1070094004 10:73318540-73318562 GATGAAATATATAAAGCACTAGG - Intronic
1070239075 10:74660054-74660076 GTTAATACATATAAAGCACTTGG - Intronic
1070260457 10:74849721-74849743 GATAATAAATGTAAAGCACTTGG - Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1070638825 10:78151248-78151270 GGTTATGTATAGATAACACTGGG + Intergenic
1071197838 10:83182053-83182075 GGCAATGTATTTAAAGCCATTGG - Intergenic
1071200163 10:83212915-83212937 AATAATGTATACAAAACACTTGG - Intergenic
1071229958 10:83574245-83574267 AGTAATGTATGTATAGCACTTGG - Intergenic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1072330571 10:94345888-94345910 GATGATGCATATAAAACACTTGG - Intronic
1072990943 10:100193055-100193077 GACAATGTATATAAAGTGCTTGG - Intronic
1074292591 10:112150519-112150541 GGTAATGAACAGATAGCACTGGG - Exonic
1075125952 10:119699055-119699077 GGTAATGCAGGTAAAGCACTTGG - Intergenic
1077869093 11:6246620-6246642 ACTAATGTGTATCAAGCACTAGG + Intergenic
1078324358 11:10367578-10367600 AACAATGCATATAAAGCACTTGG + Intronic
1078732257 11:13985638-13985660 GCTAATGCATATAAAGCACCTGG - Intronic
1078961509 11:16277963-16277985 GATCATGTATTAAAAGCACTTGG + Intronic
1079523370 11:21355392-21355414 GGTAGTGCATGTAAAGCACTTGG - Intronic
1079679580 11:23277981-23278003 GATAATGTATATAAAGTGCTTGG + Intergenic
1079796815 11:24813993-24814015 ATTAATGTTTGTAAAGCACTTGG + Intronic
1080133269 11:28821462-28821484 GACAATGTATATAAAGTTCTTGG - Intergenic
1080236592 11:30075874-30075896 AATAATGTCTATAAAGTACTTGG - Intergenic
1080280493 11:30551230-30551252 GGTAATGTTCATAAAGTGCTTGG - Intronic
1080407427 11:31991927-31991949 GTTAATACATCTAAAGCACTTGG - Intronic
1080574236 11:33583701-33583723 GCTGCTGTATATAAAACACTTGG - Intronic
1080711650 11:34753699-34753721 AATAATGTCTGTAAAGCACTTGG - Intergenic
1082805993 11:57450918-57450940 GATAATGTATATAAAGCTTCTGG + Intergenic
1083231302 11:61322102-61322124 GATAATGTATATAAAGTGCCTGG + Intronic
1085001085 11:73035552-73035574 GTCAGTGTTTATAAAGCACTTGG + Intronic
1085132417 11:74052321-74052343 GATAATATATGTAAAGTACTTGG - Intronic
1085140510 11:74136611-74136633 GATTATGTATATAAAGCACTTGG + Intronic
1085187311 11:74586928-74586950 GTTAATATTTGTAAAGCACTTGG + Intronic
1085715334 11:78867676-78867698 AATAATATAAATAAAGCACTTGG - Intronic
1085756659 11:79207360-79207382 GATAATACACATAAAGCACTTGG - Intronic
1085863232 11:80258064-80258086 GGGAATGTAAATACACCACTGGG + Intergenic
1085918513 11:80922233-80922255 GATAATATAAGTAAAGCACTGGG + Intergenic
1086121209 11:83306146-83306168 GATAATGCATACAAAGCACTTGG + Intergenic
1086271491 11:85072554-85072576 CGAAATGTATTTAAAGCCCTTGG - Intronic
1086379613 11:86238554-86238576 ACTAATGTAGATAAACCACTAGG - Intergenic
1086406449 11:86503226-86503248 GTTAATCTATGTAGAGCACTTGG + Intronic
1086423439 11:86660414-86660436 AGTAATGTATGTAAAGCAGATGG - Intronic
1086520870 11:87666364-87666386 GGGAATGTACAAAAAGCACAAGG - Intergenic
1086557368 11:88126913-88126935 GGCACTGAAAATAAAGCACTTGG + Intronic
1086881157 11:92155197-92155219 GGTAATACATATAAAGCACTAGG - Intergenic
1086943178 11:92819017-92819039 AATAATGTATCTAAGGCACTTGG - Intronic
1087021158 11:93604737-93604759 GTTAATGTGTATAAATCATTAGG - Intergenic
1088575288 11:111265574-111265596 GATAATGTCTACAAAGCACCTGG + Intronic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089164310 11:116462781-116462803 GATGATGTATTTAAAGAACTTGG - Intergenic
1089180676 11:116581039-116581061 GGTCGTGTTTGTAAAGCACTTGG + Intergenic
1090202662 11:124867293-124867315 CATAATGTATGTAAAGCCCTTGG - Intronic
1090346272 11:126073888-126073910 AATAATGCATATAAAGTACTTGG + Intergenic
1091191997 11:133703785-133703807 TTTAATATCTATAAAGCACTTGG - Intergenic
1091566645 12:1653704-1653726 TGTAATGTATGTAAAGCAGCTGG - Intergenic
1091642053 12:2244762-2244784 GTTAATGCTGATAAAGCACTTGG + Intronic
1091714074 12:2764572-2764594 GACAATGTTTATAAAGTACTTGG - Intergenic
1092987180 12:13856889-13856911 GGAAATGTCTAGTAAGCACTTGG - Intronic
1092989939 12:13886879-13886901 ATTACTATATATAAAGCACTTGG - Intronic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094168350 12:27465238-27465260 GGTAATATATGTAAAACACTTGG + Intergenic
1094320675 12:29179428-29179450 GGGAATGTATGTAAAGAACCTGG - Intronic
1094627537 12:32138342-32138364 GTTAATATATTTAAAGCACTTGG - Intronic
1094749331 12:33387394-33387416 GATAATGTAAATAAAGCATAAGG + Intronic
1095890225 12:47228900-47228922 GGTAATGTTGGTAAAGCACCTGG + Intronic
1098261091 12:68671624-68671646 GGTAATGCATATTAACAACTTGG - Exonic
1098363578 12:69679272-69679294 GATAACGTATATAAAGCACTTGG + Intronic
1098454242 12:70654166-70654188 GATAATATATGTAAAACACTTGG - Intronic
1098497434 12:71152469-71152491 GTTAATATATATAAAGAAGTAGG - Intronic
1099243525 12:80166764-80166786 CCTAATGTATATCAATCACTGGG + Intergenic
1099313334 12:81054853-81054875 GATAATGCATATAAAGTGCTTGG - Intronic
1099701716 12:86092364-86092386 AGTAATTTATATAAATAACTAGG - Intronic
1099877408 12:88425757-88425779 GTTAATGTACGTAAAGCACTTGG + Intergenic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1100949710 12:99832976-99832998 GCTAATGCATATAAAGCATTTGG - Intronic
1101269488 12:103128658-103128680 GATAATGTATATAAAGTGCTAGG + Intergenic
1101419318 12:104536700-104536722 GAGAATGTTTATAAAACACTTGG + Intronic
1101796310 12:107977778-107977800 GAGAATGAATGTAAAGCACTTGG - Intergenic
1101967743 12:109292560-109292582 GTAATTGTATGTAAAGCACTTGG + Intronic
1102020764 12:109680689-109680711 GGCAATGTTTATAAAGTACTAGG - Intergenic
1102854858 12:116284860-116284882 GTTACTGTACACAAAGCACTTGG + Intergenic
1103363098 12:120365387-120365409 GATAATGCATACAAAGCATTTGG + Intronic
1104172735 12:126298108-126298130 GGTGATTTGTATAAAGCAGTAGG - Intergenic
1104249023 12:127072140-127072162 GGTAATAAATGTAAAGCACTTGG + Intergenic
1105989231 13:25601897-25601919 GATAATTTATATAAAGTGCTAGG - Intronic
1107161399 13:37233019-37233041 AATAATATATCTAAAGCACTTGG - Intergenic
1108280472 13:48856246-48856268 GATAATGAACATAAAGCACTTGG - Intergenic
1109694606 13:65937465-65937487 GGTAATAAATATTAAGCATTTGG - Intergenic
1110099143 13:71573579-71573601 GGGAATGAATATAAATTACTTGG + Intronic
1111449531 13:88396396-88396418 GTTAATTTATATAAAGAACTTGG + Intergenic
1111955962 13:94758817-94758839 GGAAATGAAAAGAAAGCACTTGG + Intergenic
1111975795 13:94966280-94966302 GGTAAGTTATAGAAAGCAATAGG - Intergenic
1112464981 13:99635876-99635898 GATAATATATATAAAGTGCTTGG + Intronic
1112540875 13:100311373-100311395 GGTTAAGTATATAAAGGGCTTGG + Intronic
1114200261 14:20513503-20513525 GGTACTGTAGATAAGGGACTGGG - Intergenic
1114297096 14:21339714-21339736 AGTCATGAATATCAAGCACTTGG - Intronic
1115012760 14:28570060-28570082 GTTAATATTTATAAATCACTTGG + Intergenic
1115102328 14:29717567-29717589 GTTAATATATGTGAAGCACTTGG + Intronic
1115786673 14:36834493-36834515 GATAATGTGTATAAAATACTTGG + Intronic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1116248880 14:42456005-42456027 GGGAATGTATATTAAGCATATGG + Intergenic
1116280407 14:42899473-42899495 GTAAATGTAAATAAACCACTTGG - Intergenic
1116403394 14:44537697-44537719 AGTAATGTACATAAAGAGCTTGG + Intergenic
1116976402 14:51120874-51120896 GCTAACATATATAAAGCACTTGG + Intergenic
1117375129 14:55112593-55112615 GAGAATGTGTATAAAGCCCTTGG + Intergenic
1118006233 14:61566339-61566361 GGGCATGTGTATAAAGCACGTGG + Intronic
1118156404 14:63246557-63246579 GATAATTCACATAAAGCACTTGG + Intronic
1118398461 14:65357187-65357209 GTTAGTGTATTTAAAGTACTTGG + Intergenic
1118782516 14:69018275-69018297 AATAATGTATGTAAAGCAGTTGG - Intergenic
1119422385 14:74515097-74515119 GCTAATGTATACAAAGTGCTAGG - Intronic
1119583312 14:75807533-75807555 GATAATGCATATAAAGTCCTTGG - Intronic
1119749572 14:77067833-77067855 GGTAATATACATGGAGCACTTGG - Intergenic
1120000887 14:79302176-79302198 TGTAATATATGTAAAGCACCTGG - Intronic
1120761196 14:88287006-88287028 GTTAATGCATGTAAAGCACTTGG - Intronic
1121399599 14:93661721-93661743 GATAATATATGTAAAGCACTTGG - Intronic
1121520098 14:94580342-94580364 GATAATGCGTTTAAAGCACTTGG + Intronic
1121617952 14:95326112-95326134 GATAATACATACAAAGCACTTGG - Intergenic
1124402455 15:29361375-29361397 GCCAATGTATAAAAAGCACCAGG + Intronic
1125719816 15:41839923-41839945 GTTAATGTATGCAAAGCCCTTGG + Intronic
1128152810 15:65373785-65373807 AGTAATTCATGTAAAGCACTTGG + Intronic
1128795585 15:70464260-70464282 GGTCATTTATATAAAGTACTTGG + Intergenic
1128901301 15:71424887-71424909 GGTCATGTGGATAAGGCACTAGG + Intronic
1128904934 15:71458485-71458507 GATAAGGTGTATAAAGTACTTGG + Intronic
1129093621 15:73179636-73179658 GGAAAAGTATATAAAGGACATGG + Intronic
1129198394 15:73984379-73984401 GATAATGTACAAAAAGTACTTGG + Intronic
1129627799 15:77222409-77222431 AGTAATATATATGAAACACTTGG - Intronic
1129984376 15:79904433-79904455 GTTAATGTAAACAAAGCACTTGG - Intronic
1130723434 15:86412864-86412886 GATAATATATGTAAAGTACTTGG - Intronic
1131123722 15:89840351-89840373 GGTAAGTTACATAAAGTACTTGG - Intronic
1131352735 15:91716512-91716534 GCTGATATATATAAAGCACTTGG + Intergenic
1131432568 15:92398508-92398530 GTTAACATCTATAAAGCACTTGG - Intronic
1131798146 15:96041649-96041671 GGTAATGCATATACATCATTTGG - Intergenic
1132344422 15:101099734-101099756 GAAAATGTGTATAAATCACTTGG + Intergenic
1133890185 16:9871718-9871740 GGTAATGTACATAAAGTGGTTGG + Intronic
1133907112 16:10032534-10032556 GTTAATTTATATAAAGCACTTGG - Intronic
1134385844 16:13771654-13771676 GGTAAGGTTTATAAAGCACTTGG - Intergenic
1134838775 16:17384151-17384173 AATAATGTATGTAAAACACTTGG + Intronic
1135431577 16:22388275-22388297 GGTAATGTACACAATGCACTTGG - Intronic
1135726984 16:24862228-24862250 GGTAATGCATATAAAGTGCTTGG + Intronic
1136655636 16:31707515-31707537 AATAATGCTTATAAAGCACTTGG - Intergenic
1137681490 16:50350138-50350160 GGAAATGAAAAGAAAGCACTTGG + Exonic
1138196134 16:55053602-55053624 GTTAATGCATATGAAGCAATTGG + Intergenic
1138331213 16:56216952-56216974 GTTAATCCAGATAAAGCACTTGG + Intronic
1139345276 16:66298997-66299019 GATAATGTATGTAAATCACTTGG + Intergenic
1140185897 16:72771555-72771577 GGTAAGATATATAAAGCACATGG - Intergenic
1140789814 16:78380685-78380707 GGCAATGTATCTAAAGCAGTTGG - Intronic
1140925302 16:79576765-79576787 GATAATGTATGTAAAGCACCTGG - Intergenic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1140970230 16:80005576-80005598 GATAATGAGTATAATGCACTTGG - Intergenic
1141319613 16:82995015-82995037 CATAATGTTTACAAAGCACTTGG + Intronic
1144317994 17:14082181-14082203 GGTAAGGTATATAATGGACCCGG + Intronic
1144460373 17:15453905-15453927 GATAATTCATATACAGCACTGGG + Intronic
1145782726 17:27573841-27573863 AATAATGTATACAAAGCCCTAGG + Intronic
1146424179 17:32720329-32720351 GATAATATATACAAAACACTTGG - Intronic
1146483076 17:33220632-33220654 GTTAATGTATACAAAGCACCCGG + Intronic
1146523290 17:33543666-33543688 GGTAATGTACGTAAAGTACTTGG - Intronic
1146726846 17:35163156-35163178 GTGAATGTGTATAAAGCTCTTGG + Intronic
1147308785 17:39581597-39581619 GATAATCAATATAAAGCATTTGG - Intergenic
1147490312 17:40859905-40859927 GGTCGTGTACCTAAAGCACTAGG - Intergenic
1148024991 17:44580915-44580937 ATAAATATATATAAAGCACTTGG - Intergenic
1148357052 17:46982464-46982486 GGTAATGTATTTAATGCACTGGG - Intronic
1149073199 17:52568289-52568311 AGTAATGAATATAAAACACATGG - Intergenic
1149177957 17:53897145-53897167 GGTGAGGTATTTAAAGCAGTTGG - Intergenic
1149322417 17:55494978-55495000 GGCAATGTATGCAAAGCGCTTGG + Intergenic
1149419359 17:56493992-56494014 GATAATACATATAAAACACTCGG + Intronic
1151162360 17:72176155-72176177 GGCAGTGTGTATAAAGCACGGGG - Intergenic
1151858434 17:76739264-76739286 GACAATGCATGTAAAGCACTTGG + Intronic
1153336233 18:3928568-3928590 ACTAATGTATTTGAAGCACTTGG - Intronic
1153592945 18:6693662-6693684 ATTAATGTTTATAAAGTACTGGG + Intergenic
1154380330 18:13843836-13843858 GGTAATGCATTTAAAGCACTTGG + Intergenic
1156102829 18:33619042-33619064 GGTAATTTATGTAAAGTCCTTGG - Intronic
1156322012 18:36035356-36035378 GATAATGTATGTAAAGTGCTTGG - Intronic
1156894699 18:42232426-42232448 AATAATGCATGTAAAGCACTTGG - Intergenic
1157465772 18:47943619-47943641 GGTAATGGATATAGAGAAATAGG + Intergenic
1157797274 18:50586622-50586644 GATAATCCATATAAAACACTTGG + Intronic
1158334489 18:56400872-56400894 AGTAATGTACATAAAGCTCAAGG - Intergenic
1158395162 18:57073594-57073616 GATGATGCATATAAAGCCCTCGG - Intergenic
1158622616 18:59046214-59046236 GATAATGTATGTAAAGAACTTGG + Intergenic
1159642057 18:70875306-70875328 GATAATGCATAAAAAGTACTCGG - Intergenic
1163025589 19:14509550-14509572 GCAAATATATCTAAAGCACTTGG - Intergenic
1163093424 19:15037138-15037160 GTTAATGTATCTAAAACACTTGG - Intergenic
1165380876 19:35479274-35479296 GATAATATATGCAAAGCACTTGG + Intergenic
1166289475 19:41853051-41853073 AATAATGTTTATAAAGCATTGGG + Intergenic
1166541124 19:43606804-43606826 GTCAATATATATAAAGCCCTTGG + Intronic
1167127933 19:47563951-47563973 GTTAATGCATATAAAGCACTTGG - Intergenic
1167194353 19:48017003-48017025 GATATTGTATACAAAGCTCTTGG - Intronic
1168174925 19:54620019-54620041 GGTGATGCATATAAAACACAAGG + Intronic
1168550359 19:57288187-57288209 GAAAATTTCTATAAAGCACTTGG - Intronic
925623258 2:5815730-5815752 GGTGAAAGATATAAAGCACTGGG - Intergenic
925683310 2:6445712-6445734 AGTAATGCATATAAAGCACCTGG - Intergenic
926133979 2:10323677-10323699 GGTCATGCGTATAAAGCAGTAGG - Intronic
926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG + Intergenic
926589300 2:14722789-14722811 GATAATAAATGTAAAGCACTTGG - Intergenic
926932733 2:18056564-18056586 GATAATGCATGTAAAGCACCTGG + Intronic
927372670 2:22375165-22375187 GTTAATATTTTTAAAGCACTAGG - Intergenic
927424000 2:22960841-22960863 GACAATGTATGCAAAGCACTTGG + Intergenic
927473282 2:23392546-23392568 GATAATATATGTAAAGTACTCGG - Intronic
927749178 2:25651193-25651215 GATAATGTGAATAAAGCACTTGG - Intronic
927957547 2:27218026-27218048 AGGAATGTAGAGAAAGCACTGGG - Intronic
928422533 2:31149933-31149955 GATAATGTATACAAAGCACCTGG + Intronic
928493859 2:31812035-31812057 GTTAATGGATATAAAGCATTTGG + Intergenic
928694659 2:33837052-33837074 GATAATGTATATAAAACACTTGG - Intergenic
929407779 2:41662765-41662787 GTTAATATGTGTAAAGCACTTGG - Intergenic
929659034 2:43764705-43764727 GATAATGTGTATAAAGTACCAGG - Intronic
930411932 2:51035039-51035061 GTTAATGTAAGTAAAGCACTTGG - Intergenic
930441473 2:51412934-51412956 GATAATGTGTATAAAGGACTCGG + Intergenic
930633562 2:53780946-53780968 GTTAATATACATAAAGCACTTGG - Intronic
932131815 2:69194516-69194538 AGTAATGTTTGTAAAGCATTTGG + Intronic
932155973 2:69418008-69418030 GATAACATATGTAAAGCACTAGG + Intronic
932477432 2:72015032-72015054 GCAAATGTATGTAAAGCATTTGG - Intergenic
932782809 2:74572749-74572771 GGTAAAGTATGCAAAACACTTGG + Intronic
933192012 2:79344926-79344948 GATAGTGTATGTAAAGTACTTGG + Intronic
933620756 2:84538227-84538249 ATTAATGTACAGAAAGCACTTGG - Intronic
933796849 2:85926853-85926875 GGTAATGCATGTAATGCACCTGG + Intergenic
933822341 2:86124876-86124898 GATAATGTATAGAAAGTACTTGG + Intronic
934603945 2:95680151-95680173 GATAATGTATATGTAGCACTAGG - Intergenic
935229491 2:101083471-101083493 GGTAATCTTTATAAAGCCTTGGG + Intronic
935880591 2:107560866-107560888 GCTAATATTTATAAAGCACTTGG + Intergenic
936002945 2:108852091-108852113 GTTAATATATATAAAGTGCTCGG - Intronic
936537329 2:113322380-113322402 GATAATGTATATGTAGCACTAGG - Intergenic
936988331 2:118333670-118333692 AATAATGTATGTAAATCACTTGG - Intergenic
937005313 2:118506850-118506872 GATAGTGTATGTAAAGCACCTGG + Intergenic
939309652 2:140459589-140459611 GGTGATATTTATTAAGCACTTGG + Intronic
939891463 2:147741847-147741869 GATAATGTAAATAAAACACTTGG + Intergenic
939928050 2:148198436-148198458 AATAATGTACATAAAGCATTTGG + Intronic
940136509 2:150442297-150442319 AATAATGTATGTAAAGCACTTGG + Intergenic
940807599 2:158205502-158205524 AATGATGTATATAAAGCACCCGG - Intronic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
941499933 2:166261452-166261474 GGTATTGGATATAAAGCTGTAGG + Intronic
941617339 2:167735721-167735743 GATAATGTATCTAGGGCACTTGG - Intergenic
941848964 2:170159805-170159827 GTTAATCTTTAAAAAGCACTTGG + Intergenic
942804702 2:179916536-179916558 AGTAATATATGTAAAGTACTTGG - Intergenic
943056276 2:182984814-182984836 GAAAATGTCTATAAAGTACTTGG + Intronic
943728193 2:191273772-191273794 GAGAATGTATGTAGAGCACTGGG - Intronic
944320132 2:198331060-198331082 GATAATATATGTAAAGCGCTTGG + Intronic
944489944 2:200248180-200248202 GATAATGCATGTAAAGCACTTGG + Intergenic
944639739 2:201712352-201712374 GGTAATTTATTTAAAGAATTTGG + Intronic
945468602 2:210200917-210200939 GGTAATATACATAAAGCGCTTGG - Intronic
945889294 2:215411322-215411344 GGTAATTTTTAAAAATCACTGGG - Intronic
946108629 2:217394308-217394330 AATAATTTATATAAAACACTTGG - Intronic
946245936 2:218387443-218387465 GGTAACATATGTTAAGCACTTGG + Intronic
947894920 2:233661457-233661479 GTTAATGGATAAAAAGAACTAGG - Intronic
948249786 2:236517412-236517434 AACAATGTATGTAAAGCACTTGG + Intergenic
1168982609 20:2020742-2020764 GATAATGCATATAAAGCATTTGG - Intergenic
1169033120 20:2428573-2428595 TATAATGTATATAAAGTATTTGG + Intronic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1170130638 20:13015347-13015369 GGTAATGCATAAAAAGCAATTGG + Intronic
1170130731 20:13016862-13016884 GATGATGAACATAAAGCACTGGG - Intronic
1171115878 20:22524387-22524409 GATAATCTATGTAAAGCACCTGG + Intergenic
1171223081 20:23419101-23419123 GGTTATGTTTATAAAACATTTGG - Intronic
1172020463 20:31910189-31910211 GGTAACGCAGGTAAAGCACTTGG - Intronic
1172330381 20:34071853-34071875 GGGAATGTATGTAAAGCACCTGG + Intronic
1172681287 20:36717657-36717679 GAGAATGTATGTAAAGCACTTGG + Intronic
1172762096 20:37330145-37330167 GTTAATGCATATAAGGCACTTGG + Intergenic
1172945822 20:38688430-38688452 GGTACTATATATAAAACTCTCGG + Intergenic
1173102627 20:40101331-40101353 GATAATTCACATAAAGCACTTGG - Intergenic
1173127885 20:40356976-40356998 AGCAATGTATGTAAAGCATTTGG + Intergenic
1174214787 20:48908068-48908090 GTTAATGTATATGCAGCACCTGG - Intergenic
1174754677 20:53145897-53145919 GGTAATAAATAGAAAGCACTTGG + Intronic
1176597568 21:8761186-8761208 GGTAATGTGTCTAGAGCATTGGG + Intergenic
1176934639 21:14852086-14852108 GATAATGTACATCAAACACTTGG - Intergenic
1177363759 21:20106204-20106226 GTTAAGGTATATAATGCATTTGG - Intergenic
1177800883 21:25827510-25827532 GCTATTGTATACAAAGGACTAGG - Intergenic
1177808753 21:25902145-25902167 AGTCATGATTATAAAGCACTGGG + Intronic
1178113610 21:29394993-29395015 GATAATGTTTATCAAGCAGTGGG - Intronic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1179294204 21:40046106-40046128 GGTCATGTAGACACAGCACTAGG - Intronic
1181788580 22:25245379-25245401 TGTAATGAAAATCAAGCACTCGG + Intergenic
1181820269 22:25470068-25470090 TGTAATGAAAATCAAGCACTCGG + Intergenic
1181987165 22:26808031-26808053 GATAATTTATTCAAAGCACTTGG - Intergenic
1183142077 22:35951680-35951702 GATAATGTTTATAAAACACTAGG - Intronic
1183265349 22:36821574-36821596 GATAAAGCACATAAAGCACTAGG - Intergenic
1184534983 22:45080567-45080589 GCAAATGTATGTAAAGCACTTGG - Intergenic
1184801167 22:46761035-46761057 GGTAAGCTATAAAAAGCACCCGG + Intergenic
949370859 3:3333444-3333466 GAGGATGTCTATAAAGCACTTGG - Intergenic
949566905 3:5253475-5253497 GACAATGTACATAAAGCACTGGG - Intergenic
950374359 3:12557727-12557749 GATAATGAATATAAAGGACTTGG - Intronic
951041186 3:17990314-17990336 GTTAATCAATGTAAAGCACTTGG + Intronic
951547054 3:23837138-23837160 AGAAATGTATATAAAGCACTTGG + Intronic
952179007 3:30898094-30898116 GGGAATGTATAAAAAGCATTTGG - Intergenic
952497555 3:33929135-33929157 GCTAATGTATATAAGGCCCAGGG - Intergenic
952622207 3:35359219-35359241 TATAATGCATATTAAGCACTTGG + Intergenic
953200983 3:40778379-40778401 GGTAATGTCTATAAAGCACCTGG + Intergenic
954211112 3:49097908-49097930 GGGAATGTATGCAGAGCACTTGG + Intronic
954684538 3:52363234-52363256 GGTAATGCCTGTAAAGCACCGGG - Intronic
955250994 3:57282213-57282235 GATAATGTCTAAAAAGCACAAGG + Intronic
955568143 3:60271924-60271946 AACAATGTACATAAAGCACTTGG - Intronic
955696266 3:61640481-61640503 GGTAATGTGCAAAAAGCACCTGG - Intronic
955803458 3:62709509-62709531 GATACTGTATACAAAGCACTTGG + Intronic
955896844 3:63709451-63709473 GACAATGTATATAAAGCATTTGG - Intergenic
956104841 3:65807021-65807043 GAAAGTGTATATAAAGTACTTGG - Intronic
956875267 3:73456952-73456974 GGTAATGTCTATTAAGTACCAGG - Intronic
957211519 3:77265115-77265137 GGCAATGTAAATGAAGCCCTTGG - Intronic
957468335 3:80624763-80624785 GATAATGGATATAAATCACATGG + Intergenic
957546282 3:81642279-81642301 GCTAATATATCTAAAACACTTGG + Intronic
957843888 3:85705290-85705312 ATCAATGTACATAAAGCACTTGG - Intronic
958431970 3:94050298-94050320 AGTAATGCATATAAAACACTGGG + Intronic
958906733 3:99950121-99950143 GGTAAAGTTTATAAAGCACAAGG + Intronic
959088991 3:101882144-101882166 GGTAATAAATATAAATCAATGGG - Intergenic
959835901 3:110917635-110917657 AATAATGTATGTAAAGCAGTTGG - Intergenic
960026659 3:113018747-113018769 GATAATGTAGAGAAAGCATTTGG - Intronic
960419285 3:117423906-117423928 AATAATGTTTATCAAGCACTTGG - Intergenic
960804380 3:121568732-121568754 AATCATGTATATGAAGCACTTGG + Intergenic
960830708 3:121843572-121843594 GCTAATGTATATATAACACAGGG + Intronic
960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG + Intronic
960978950 3:123203346-123203368 GGTAATGTGTATAAAGTGCGTGG + Intronic
960982484 3:123243329-123243351 GACCAAGTATATAAAGCACTTGG + Intronic
961095019 3:124147011-124147033 AATAATTTATATAAAGCACATGG - Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
961133548 3:124490461-124490483 GGTTATGTATATAAAAGACATGG + Intronic
962124690 3:132604033-132604055 TGTATTGTCTACAAAGCACTAGG - Intronic
962469803 3:135696386-135696408 TGTAATGTAGGTAAAGCACTTGG - Intergenic
962698051 3:137970441-137970463 GGTAATATATACAAGGCACCTGG - Intergenic
962705077 3:138035406-138035428 GTTAAAGTATATAAAGCACTAGG - Intergenic
963231346 3:142911376-142911398 GGGAATGCATGCAAAGCACTTGG + Intergenic
964198067 3:154087637-154087659 GACAATATATATAAAGCACCTGG + Intergenic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
964449483 3:156797725-156797747 GATAATGTATATAAAACATCTGG - Intergenic
964738961 3:159945461-159945483 GATATTGCATATAAGGCACTTGG - Intergenic
964757453 3:160101301-160101323 GGAAATGAAAAGAAAGCACTTGG - Intergenic
965461398 3:168969052-168969074 GGTACTGTATATAAAGTATTTGG - Intergenic
965642960 3:170850390-170850412 GATAATATATTTAAAGCACCTGG + Intronic
965663623 3:171068234-171068256 GGTAATGGATCTAAAGCAGTTGG - Intronic
965663701 3:171069254-171069276 GGTAATGTATATTAAAAACCTGG + Intronic
965881471 3:173393684-173393706 AATAATGCATGTAAAGCACTTGG - Intergenic
966270354 3:178097282-178097304 GATAATGTATGTAAAGCACCTGG + Intergenic
966493589 3:180555624-180555646 GGTAATTTATAAAGAGTACTGGG - Intergenic
966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG + Intergenic
966659988 3:182403539-182403561 GATAATGTCTGTAAAGCACTTGG + Intergenic
967217631 3:187223975-187223997 GTTAATGAACATAAAGCACCTGG + Intronic
967675176 3:192289740-192289762 ATTAGTGTAAATAAAGCACTTGG + Intronic
967891317 3:194366292-194366314 GTTAATGCATGTGAAGCACTTGG + Intronic
968217061 3:196901563-196901585 GGTAAGTTTTATACAGCACTTGG - Intronic
969428530 4:7139657-7139679 GGTCATGTATTTGAAGGACTTGG - Intergenic
969841184 4:9883521-9883543 GGTGATGTATATAAGGCAGCTGG + Intronic
971001000 4:22322355-22322377 GTTAATATATATGAAGCCCTCGG + Intergenic
971396276 4:26230414-26230436 GTTAATATATGTAAAGCACTTGG - Intronic
972230131 4:37062877-37062899 GCTAATGTTTATTTAGCACTGGG + Intergenic
972377990 4:38491040-38491062 GATAATGTATATAAAGTACTTGG - Intergenic
972741147 4:41887279-41887301 GATAATTCACATAAAGCACTTGG - Intergenic
972843894 4:42964494-42964516 GCTAATACATATTAAGCACTTGG + Intronic
973302040 4:48596623-48596645 GTTAATATCTGTAAAGCACTTGG + Intronic
974618970 4:64331067-64331089 GGGAATCTATATAAAGCCCTAGG + Intronic
974897451 4:67956752-67956774 AGAAATGTGTATAAAGTACTTGG - Intronic
975087704 4:70363430-70363452 GATAATGTATGTAATGCATTTGG - Intronic
975337700 4:73199415-73199437 GGTACTCTATATAAAGTAATGGG - Intronic
975651195 4:76595158-76595180 GATAATACATATAAAGCACTTGG + Intronic
975824857 4:78308740-78308762 GTTAATATTTATAAAGCACTTGG - Intronic
976495427 4:85724096-85724118 GGTAATGTGTATAGAACCCTCGG + Intronic
977801359 4:101237036-101237058 AATAATTCATATAAAGCACTTGG + Intronic
977818016 4:101438864-101438886 GGTAATATATAAAAACCCCTTGG - Intronic
978084765 4:104637354-104637376 GGAAATGTACAGAAAGCAATTGG - Intergenic
978324963 4:107542798-107542820 GGTACTGTTTATTAAGCACATGG - Intergenic
978403119 4:108351338-108351360 GATAATGAATGTAAAACACTTGG - Intergenic
978627703 4:110705895-110705917 GATAATGCACATAAAGCACCTGG + Intergenic
978636024 4:110808365-110808387 GATAGTATATATAAAGCATTTGG + Intergenic
978930612 4:114306859-114306881 TGTCATTTATATAAAGCTCTAGG - Intergenic
978978944 4:114917876-114917898 GTTAATGCATAGAAAGCATTTGG + Intronic
979119653 4:116881705-116881727 AATGATGTATATGAAGCACTGGG - Intergenic
979430373 4:120622321-120622343 GTTAATATATGTAAAGCACTTGG - Intergenic
979632382 4:122918401-122918423 GATAATATATATAAAGTGCTTGG - Intronic
980157783 4:129127851-129127873 GAAAATGCATATAAAGTACTTGG - Intergenic
981502130 4:145463212-145463234 GGGAATGTGTATAAAGCATAAGG - Intergenic
981911409 4:149985628-149985650 GATGATGTATGAAAAGCACTTGG - Intergenic
982413253 4:155103373-155103395 GGTAATGTATACAAAGACATAGG - Intergenic
982724707 4:158893402-158893424 GAGAATGAATGTAAAGCACTTGG + Exonic
982870384 4:160572849-160572871 AGTAATATTTATAAAGCTCTTGG + Intergenic
983382498 4:167015248-167015270 GGCAATGTTTATAAAAGACTTGG + Intronic
983385937 4:167060911-167060933 AGTAATATATATCAAACACTTGG + Intronic
984025051 4:174533154-174533176 GATAATGTGTATAAACCTCTAGG - Intergenic
984632198 4:182073062-182073084 GGTAATTTATATAAAGAAAAGGG + Intergenic
984655372 4:182311660-182311682 GGTCATATATGTAAAGCACCTGG + Intronic
985479582 5:100794-100816 GTTAATCCATATAAAGCCCTGGG + Intergenic
986110087 5:4707086-4707108 GGTAATGTATAAAGAGCAGAGGG - Intergenic
986579581 5:9251250-9251272 GGTAATTTATATAAAATATTAGG - Intronic
987297208 5:16564392-16564414 GACAATGTAGAAAAAGCACTTGG + Intronic
987431660 5:17842456-17842478 GGCAAGGTATATAAAAAACTAGG - Intergenic
988407209 5:30839182-30839204 GGTGATGTGGATAAAGCACTTGG - Intergenic
988664681 5:33312742-33312764 GGTAATATATATAAAATTCTTGG + Intergenic
988907922 5:35809119-35809141 GGTCATGCATGTAAAGCACTTGG + Intronic
989535371 5:42557517-42557539 GATAATTTATTTAAAGCATTTGG - Intronic
989730229 5:44640360-44640382 GGTAATATATATAATACAGTAGG - Intergenic
990570243 5:57071221-57071243 GTTAATGTATGTAAAATACTTGG + Intergenic
990761345 5:59133418-59133440 GGTAATTTATTTGAAGCATTTGG + Intronic
991099899 5:62780878-62780900 GTAAATGTATATAAAGGGCTTGG - Intergenic
991252943 5:64583942-64583964 GATAATGTGTATAATGCACCTGG - Intronic
991603713 5:68379387-68379409 GATAATGAATATAAAGGGCTGGG - Intergenic
991630676 5:68653797-68653819 GGTAATGCACATAAAGTGCTTGG + Intergenic
992503354 5:77363112-77363134 GTTAATGTATGAAATGCACTTGG - Intronic
993050176 5:82917373-82917395 GTTAATATATATAAAGCTCTTGG + Intergenic
993235102 5:85295082-85295104 GATACTGTATCTGAAGCACTGGG - Intergenic
995070138 5:107911496-107911518 GTTAATATATATAAAGTACCTGG - Intronic
995327135 5:110903550-110903572 GATAATGTAGATAAAGGACTAGG - Intergenic
995404412 5:111778307-111778329 TATGATGCATATAAAGCACTTGG - Intronic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996691362 5:126343671-126343693 GACAATGTATATCAAGCACATGG + Intergenic
997131521 5:131281894-131281916 AGTAATGCACATAAAGCATTTGG + Intronic
997312995 5:132905142-132905164 GCTAATGTATATAAAATATTGGG - Intronic
998379287 5:141712558-141712580 GTTAATACATAGAAAGCACTTGG - Intergenic
998426034 5:142029429-142029451 GATAATGTGTGAAAAGCACTTGG - Intergenic
998478786 5:142444074-142444096 GGTCTTATATGTAAAGCACTTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998666860 5:144307499-144307521 AATAATGTATGTTAAGCACTTGG - Intronic
998706623 5:144769437-144769459 GATAATGTATGTAAATCATTTGG + Intergenic
999005261 5:147969256-147969278 GGTAATGTATATAAAGTGTTTGG + Intergenic
999009104 5:148015536-148015558 GATAATACACATAAAGCACTTGG + Intergenic
999090172 5:148929153-148929175 GTTAATATAGATAAAGCCCTTGG + Intronic
999124473 5:149236884-149236906 GTTAATCTATATAAGGGACTTGG + Intronic
999134671 5:149310621-149310643 GGTCACGTATGTAAAGCTCTTGG - Intronic
999316152 5:150585393-150585415 GAGAATGTATATAAAGGACCTGG - Intergenic
1000447914 5:161347160-161347182 GGCAATGCATGTAAAGTACTTGG - Intronic
1000775202 5:165411102-165411124 AATAATGTATATAAAGCGTTTGG + Intergenic
1000918065 5:167106109-167106131 GATAATGCCTATAAAGCTCTTGG + Intergenic
1000969721 5:167700345-167700367 GATAATGTTTGTAAAACACTTGG - Intronic
1001111322 5:168898700-168898722 GAGAATGTATATAAAGTAATGGG + Intronic
1001127705 5:169035338-169035360 AGTAATTCTTATAAAGCACTTGG - Intronic
1001285423 5:170419640-170419662 GATCACGTATATTAAGCACTTGG - Intronic
1001432323 5:171672685-171672707 GATAATGTCTATAAAGCGCCTGG + Intergenic
1003039864 6:2677803-2677825 GATAATGTCTACAAAGCACTTGG + Intronic
1003145416 6:3506109-3506131 GGTGATGGATACAAAGCACAGGG - Intergenic
1003530282 6:6931130-6931152 GGTATTGTTTTTAAAGCACAAGG + Intergenic
1005169939 6:22971572-22971594 GGTAAAATATATAAACCCCTTGG + Intergenic
1005356036 6:24984528-24984550 GATAATGCATTTAAAGCACTTGG + Intronic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1007616555 6:43183000-43183022 GATCATGTATGTAAAGCACTTGG - Intronic
1007691809 6:43707338-43707360 GTTAATAGATAAAAAGCACTTGG - Intergenic
1008092316 6:47306561-47306583 GATACTGTATACAAAGCACCTGG + Intronic
1008785992 6:55168843-55168865 GTTAATGTATGTAACGTACTTGG + Intronic
1010986489 6:82431148-82431170 GGTTATACATATAAAGCACCTGG + Intergenic
1012278760 6:97303658-97303680 GGTTATTTATATAAATCATTTGG + Intergenic
1012596101 6:101042424-101042446 GTTAATGTAAATGAAGCAATAGG + Intergenic
1013586851 6:111586953-111586975 GATAATGTATTAAAGGCACTAGG - Intronic
1014024130 6:116625108-116625130 GGTAGTATATATAAAGGATTTGG + Intronic
1014388299 6:120828852-120828874 GATAAGGCATATAAAGCTCTTGG - Intergenic
1014910269 6:127084103-127084125 TTTAATGTCTATAAAGCATTTGG + Intergenic
1015144431 6:129969479-129969501 AAGAATGTATGTAAAGCACTAGG - Intergenic
1015936487 6:138409958-138409980 GTTAATTTATGTAAAACACTTGG + Intronic
1016385511 6:143527162-143527184 ATTCGTGTATATAAAGCACTGGG - Intergenic
1016403532 6:143705924-143705946 GGTTATGTATATAAATTATTTGG + Intronic
1016443944 6:144113423-144113445 GGCAAAATATATAAAACACTTGG - Intergenic
1017109338 6:150917674-150917696 GATAAGGTATATAAAGTTCTTGG - Intronic
1017124309 6:151051407-151051429 GCTAATCTATACAAAGCATTTGG - Intronic
1017563761 6:155662376-155662398 GATAATGTATATAAGGCATCTGG - Intergenic
1017564109 6:155665924-155665946 AATAATGTCTATAAAGCACCAGG - Intergenic
1018621524 6:165733515-165733537 GGCAATGTCTATAAAGTGCTTGG + Intronic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1019959515 7:4447290-4447312 GGAGATGTAAAGAAAGCACTGGG - Intergenic
1020252646 7:6482328-6482350 GATAAGCCATATAAAGCACTCGG + Intronic
1020726793 7:11825632-11825654 GGTAATGCATGTAACGTACTAGG - Intronic
1021417566 7:20405876-20405898 GGTAATTTATTTAAATCATTTGG + Intronic
1021537553 7:21722655-21722677 GCTAATCTTTAGAAAGCACTTGG - Intronic
1021706464 7:23372816-23372838 GTTAAAGTAGATAAAGCATTTGG - Intronic
1021713286 7:23437802-23437824 GGAAATGTATTTCAAGTACTTGG - Intronic
1021854234 7:24838110-24838132 GGGAATGTCTGTAAAGAACTAGG + Intronic
1022053242 7:26701108-26701130 GGTAATATAAATAAGTCACTGGG - Intronic
1022125614 7:27353396-27353418 GATAGTGTATATAAAGTACCTGG - Intergenic
1022213588 7:28236159-28236181 GATAATGTATGTAAAGTACATGG + Intergenic
1022239963 7:28501027-28501049 CCTAATGTATGTAAAGCACAGGG - Intronic
1022427468 7:30283213-30283235 GATACTGCATATAAAGCACTGGG + Intergenic
1022649806 7:32264317-32264339 GATAATGTATATGAAGGGCTTGG - Intronic
1023174929 7:37426523-37426545 GATAACATATATAAATCACTTGG + Intronic
1023858764 7:44203674-44203696 GGTAATACGTGTAAAGCACTTGG - Intronic
1025985125 7:66443832-66443854 GGTAATGTCTATTATGCACTAGG + Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1026469906 7:70686264-70686286 ATTCATGTATGTAAAGCACTTGG - Intronic
1026893244 7:73995309-73995331 GGTAATCTCTGTGAAGCACTTGG + Intergenic
1028121517 7:87060210-87060232 GTTGATGTACATAAAGCACTTGG + Intergenic
1028187124 7:87800031-87800053 GATAATATATTTAAAGCCCTTGG - Intronic
1028978092 7:96936302-96936324 GATAATGTAAACGAAGCACTTGG - Intergenic
1029129458 7:98319006-98319028 GATAACGTATGTAAATCACTTGG + Intronic
1029634547 7:101775187-101775209 ATTAATGTTTATAAAGGACTTGG + Intergenic
1029866184 7:103632210-103632232 GTAACTGTAGATAAAGCACTTGG + Intronic
1032278757 7:130484034-130484056 GTTAATATGTGTAAAGCACTTGG - Intergenic
1032432306 7:131871984-131872006 GGTAAGTTATATAAAGCACTTGG - Intergenic
1032470075 7:132171879-132171901 GATAATGTATGTAAAGTGCTTGG + Intronic
1032571316 7:133002228-133002250 GATAACATATATAAAGCACCTGG - Intronic
1032578332 7:133079541-133079563 GGTAAGGTATGTAAAGCACCTGG - Intronic
1032818123 7:135497996-135498018 GTTAATGTATATAAAGTGCTTGG - Intronic
1033740802 7:144274313-144274335 GGTAATGTATCCACTGCACTAGG - Intergenic
1033753104 7:144375300-144375322 GGTAATGTATCCACTGCACTAGG + Intronic
1033779783 7:144654765-144654787 GTTAATATATATAAAGCACTTGG + Intronic
1034380799 7:150690506-150690528 GGTAATGCAGGTAAACCACTTGG + Intronic
1034886762 7:154804265-154804287 GATAATGTCTGTAAAGCACTTGG - Intronic
1035487531 7:159237638-159237660 GTTAGTATATTTAAAGCACTAGG + Intergenic
1035873438 8:3160815-3160837 GATTTTGTATATAAAGCACTTGG + Intronic
1036189767 8:6659594-6659616 GGTAATGTACAGAAACAACTGGG + Intergenic
1036544878 8:9758162-9758184 GGAAATGTAAATAAAGTGCTCGG + Intronic
1038148676 8:24922479-24922501 GGCAAATTATATAAAACACTAGG - Intergenic
1038390272 8:27191822-27191844 GGTAAGGTGTCTAAAGCTCTGGG - Intergenic
1038951651 8:32421488-32421510 GGTCATGTTAATAAAGCCCTGGG + Intronic
1041120354 8:54580176-54580198 GTCAATGTATATAAAGCACTTGG + Intergenic
1041320620 8:56608668-56608690 CATAATGTATATAAAACTCTAGG + Intergenic
1041597465 8:59672828-59672850 GATAATGTATATAAAGTACCTGG + Intergenic
1041620694 8:59964526-59964548 GGTACTGTATATAAATCATCTGG - Intergenic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1042125553 8:65534281-65534303 GTTCATGTATATAAAGTATTTGG - Intergenic
1042378110 8:68079385-68079407 GGTAATAAATATAAATAACTTGG - Intronic
1043725046 8:83600842-83600864 GGTATTTTATAAATAGCACTGGG - Intergenic
1043784902 8:84386652-84386674 GGTAACCAATATATAGCACTTGG - Intronic
1044203338 8:89461822-89461844 ATTCATGTATCTAAAGCACTTGG + Intergenic
1044331736 8:90928361-90928383 AGTCATGGATATAAAGCAATGGG - Intronic
1044946087 8:97391422-97391444 GATAATTTATGCAAAGCACTCGG - Intergenic
1044995955 8:97838440-97838462 GTTAATCTATGTAAAGCACTCGG - Intronic
1045348096 8:101312878-101312900 AGTAAAGTATATAAAGCACTTGG + Intergenic
1045593624 8:103628095-103628117 GGTACTTTATATAAGGCATTGGG + Intronic
1045704754 8:104909203-104909225 GATAATGTATATTAAGTACTTGG + Intronic
1045766068 8:105670625-105670647 GGTAATGTATAAAATGTACAGGG - Intronic
1045990834 8:108305488-108305510 GATAATGTTTATAAAACACTTGG + Intronic
1046547665 8:115671708-115671730 TGTAATGTATCTAAAGCATGAGG - Intronic
1046733213 8:117748226-117748248 GATAATGTAAGTAAAACACTTGG + Intergenic
1047023535 8:120803432-120803454 GGTTTGGTATATAAAACACTTGG + Intronic
1047175323 8:122535316-122535338 GGAAATGCACATAAAGCACTTGG + Intergenic
1047933259 8:129751130-129751152 GTTTATGTATGTAAGGCACTTGG + Intronic
1047976500 8:130135685-130135707 ACTAATGTATATAAGGCACCTGG + Intronic
1048073875 8:131047688-131047710 GGTAATTCATGCAAAGCACTTGG + Intergenic
1048211045 8:132454432-132454454 GTTTATTTATGTAAAGCACTTGG - Intronic
1049955935 9:693026-693048 GGTAATGAATTTAAATCATTAGG + Intronic
1051087355 9:13365198-13365220 TGTAATTTAAATAAAGCAGTTGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1052283656 9:26760513-26760535 GGTAGTCTAGATGAAGCACTTGG + Intergenic
1052454300 9:28675093-28675115 AATAATGTTTTTAAAGCACTAGG - Intergenic
1053352669 9:37423814-37423836 GTTTATGTATATGAAGCACCTGG - Intronic
1054824633 9:69560583-69560605 GGGAATGCATGTAAAGTACTTGG + Intronic
1054831449 9:69629916-69629938 GCTAATGTATTTCAAGCACCTGG - Intronic
1054905359 9:70409983-70410005 GATAACATCTATAAAGCACTTGG - Intronic
1054937080 9:70699555-70699577 GGTAATGTATATAAAGTGCCTGG - Intronic
1055284721 9:74716283-74716305 GGTGATGTACATAAGGTACTTGG - Intergenic
1055419850 9:76127787-76127809 GGTAATGGAAATAAAGAGCTTGG - Intronic
1055597104 9:77876460-77876482 AGTAATGTACATAGAGCACTTGG + Intronic
1055707644 9:79024001-79024023 AGTAATGCTTATAAATCACTGGG - Intergenic
1056163327 9:83919877-83919899 GGTAATATCTATAAAGAATTTGG + Intronic
1056251950 9:84757660-84757682 GCTTATATATATAAACCACTTGG + Intronic
1056325818 9:85478160-85478182 GATAGTGTATATAAAGCACTTGG - Intergenic
1057471938 9:95365734-95365756 GATAACGTTTATAAAACACTTGG - Intergenic
1057502528 9:95607083-95607105 GATAATATATATAAAGCACGTGG - Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058736849 9:107901464-107901486 GTTAATATCTATAAAGCACTTGG - Intergenic
1058773270 9:108259626-108259648 GGTAAAGTATGAAAAACACTGGG - Intergenic
1058858158 9:109087151-109087173 GGTATTGTATTTTAAGGACTTGG - Exonic
1058936076 9:109770863-109770885 GATAATGTATACAAAGCTCCTGG - Intronic
1059193283 9:112347129-112347151 GGTTATTTATATATAGCATTAGG - Intergenic
1059323730 9:113489038-113489060 GATAATGTATGTAAAGTGCTTGG - Intronic
1059711660 9:116873233-116873255 GATAATGTAGGTAAAGCATTAGG + Intronic
1059813598 9:117885354-117885376 GATAATGTTTGTAAAGCACCTGG + Intergenic
1059975667 9:119714127-119714149 GTTAATTTATACAAATCACTGGG + Intergenic
1060005995 9:120000315-120000337 TATATTCTATATAAAGCACTCGG + Intergenic
1060171569 9:121465844-121465866 GTTATTGTGTATAAAGCACTGGG - Intergenic
1060229486 9:121816041-121816063 CGTAATGTATGTAAAGAACCGGG - Intergenic
1060758623 9:126230253-126230275 GAAAATGAATATAAAGCACTTGG + Intergenic
1060768075 9:126309805-126309827 TGTAATGTATATAGAGCAGGAGG + Intergenic
1060803880 9:126562964-126562986 GATACTGTTTATAAAGCATTCGG + Intergenic
1061320732 9:129827230-129827252 GGTAATGTTTTTAAAGCCCATGG - Intergenic
1061596709 9:131635203-131635225 GATAAAGTATATAAAGTACCTGG - Intronic
1061673922 9:132204686-132204708 GGAAATGCACATAAAGGACTCGG - Intronic
1203555728 Un_KI270743v1:206175-206197 GGTAATGTGTCTAGAGCATTGGG - Intergenic
1187052908 X:15712449-15712471 AGTAATTTATATGAAGTACTTGG - Intronic
1187102308 X:16206519-16206541 GATAATGTAGATAAAACACCTGG + Intergenic
1187128841 X:16481373-16481395 GGTAATGTCATTAAAGCAGTGGG + Intergenic
1187475540 X:19607690-19607712 GATAGTGTGTGTAAAGCACTCGG - Intronic
1187546645 X:20260726-20260748 GATAATATATGTAAAGTACTTGG - Intronic
1188314273 X:28654306-28654328 GTTAATAAATATAAAGCATTTGG - Intronic
1188440671 X:30212960-30212982 GTTAATGTATGTAAAGCACCTGG - Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1188734087 X:33691075-33691097 GGTAATGGATGAAAAGTACTTGG - Intergenic
1189376218 X:40468189-40468211 GGTAATGCATATAAACCACTTGG - Intergenic
1190015497 X:46823474-46823496 GGAAATGTATGTCAAGCACAAGG + Intergenic
1192230495 X:69261327-69261349 GATAATCTATGAAAAGCACTTGG + Intergenic
1192547453 X:72025977-72025999 AGTAATACACATAAAGCACTTGG + Intergenic
1192817692 X:74611885-74611907 AATAATGCATATAAAGCACATGG + Intronic
1193239130 X:79145329-79145351 GGTTATGGATATAATGAACTTGG + Intergenic
1195720868 X:107866870-107866892 GATAATACATGTAAAGCACTTGG - Intronic
1195843474 X:109200687-109200709 GATAATGTATATAAAGTTCCAGG + Intergenic
1196897955 X:120356642-120356664 TTTAATTTATATAAAGTACTTGG - Intergenic
1197126040 X:122947512-122947534 GGTAATGTGTAAAAAACATTAGG + Intergenic
1197903705 X:131400592-131400614 AGTATTGTAAGTAAAGCACTTGG + Intergenic
1198509773 X:137338610-137338632 GATAATATATGTAAAGCACTTGG + Intergenic
1199178554 X:144823293-144823315 GTTAATGTATATAAAAGACGGGG + Intergenic
1199948732 X:152688446-152688468 TGCAATGTAAGTAAAGCACTTGG - Intergenic
1199960944 X:152780003-152780025 TGCAATGTAAGTAAAGCACTTGG + Intergenic
1201398798 Y:13579989-13580011 GGGAATGGATATTAAGCACGTGG + Intergenic