ID: 1178549174

View in Genome Browser
Species Human (GRCh38)
Location 21:33520926-33520948
Sequence CATCTGTTCCAGAGGCCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178549170_1178549174 -2 Left 1178549170 21:33520905-33520927 CCTTTAGTTTAGTTCCAACGCCA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 251
1178549169_1178549174 24 Left 1178549169 21:33520879-33520901 CCTTTATTCACAAAGGTGTCTGA 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178549174 Original CRISPR CATCTGTTCCAGAGGCCAGA AGG Exonic
900090212 1:917004-917026 CACGGGTTCCAGAGGACAGAGGG + Intergenic
901514995 1:9739271-9739293 CAGCTGTTGCAGATGCCACAGGG + Intronic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
904329042 1:29745991-29746013 CATCTGTTCCATAGGTAATAAGG + Intergenic
906379795 1:45325539-45325561 CATGAGTTCCAAAAGCCAGACGG - Intergenic
907333426 1:53685873-53685895 GAGCAGTTCCTGAGGCCAGATGG - Intronic
907762810 1:57378063-57378085 CAAATGAACCAGAGGCCAGAGGG + Intronic
909326427 1:74356806-74356828 CATATGTTGAAGAGGCCAGTGGG - Intronic
911439315 1:97905655-97905677 CGTCTAATCCACAGGCCAGATGG - Intronic
912444609 1:109725625-109725647 CATCTGTGCCTGCCGCCAGAAGG + Intronic
912500681 1:110120114-110120136 CATCTGCTCCAGAGGGCACCAGG - Intergenic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG + Intronic
917864160 1:179177328-179177350 CCTCTTTGGCAGAGGCCAGAAGG - Intronic
919119857 1:193325896-193325918 CTTCTGCTCCAGCTGCCAGAAGG + Intergenic
921126420 1:212182027-212182049 CATTTGATCCAGAGGCCCGGTGG - Intergenic
921918265 1:220638007-220638029 CATCTGTTCCACAGACTAAAAGG - Intronic
1062978999 10:1706436-1706458 CCTTTGTCCCAGAAGCCAGAAGG + Intronic
1063765291 10:9133141-9133163 GTTCTGTTGCATAGGCCAGAAGG + Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1064467311 10:15597206-15597228 CATTTGTTCCAGACACCATAGGG + Exonic
1064991465 10:21260288-21260310 CCACTTTTCCAAAGGCCAGAAGG + Intergenic
1067442985 10:46321933-46321955 CAACTTTTCCAGAAGACAGAGGG + Intronic
1068659756 10:59611900-59611922 AATCTGGTCCTGAGGCAAGAGGG - Intergenic
1069276343 10:66595668-66595690 AATCTGTTGCCCAGGCCAGAGGG + Intronic
1069604359 10:69730415-69730437 CCTCTGTTCCAGAGGACTGCTGG - Intergenic
1070370662 10:75779011-75779033 CACCTATTCCAGAGGCTAGCTGG - Intronic
1072617175 10:97057601-97057623 CATCTGGTCCAGAATCCAAAAGG + Intronic
1073040306 10:100599618-100599640 AATCTGTTCCAGACCACAGAAGG - Intergenic
1074388679 10:113038015-113038037 CATCTGTAACCCAGGCCAGAGGG - Intronic
1074509136 10:114097263-114097285 CACCTATTGCTGAGGCCAGATGG - Intergenic
1075060381 10:119252938-119252960 CAAGTGTTCCAAAGGCCAGGTGG + Intronic
1075387606 10:122068220-122068242 CATATGTTCAGGAGGCTAGAGGG - Intronic
1075473703 10:122714576-122714598 CATCTGCTTCACAGGCCAGGCGG + Intergenic
1075489527 10:122854682-122854704 CATGTGTTCCAGATGGCAAAAGG + Intronic
1076551000 10:131278096-131278118 CTCCTGTTCCTGAGGCCAGTGGG - Intronic
1076574281 10:131453601-131453623 CAGCTGGTTCAGAGGCCAGAGGG - Intergenic
1077304969 11:1864884-1864906 CTCCTGTGCCAGGGGCCAGAGGG + Intronic
1078169072 11:8914836-8914858 CATCTGTGCCAGAGGAAGGAGGG + Exonic
1079777853 11:24556749-24556771 CATATTTTCCAAAGCCCAGAAGG + Intronic
1082654289 11:55834337-55834359 CATCTGTGCCTGCCGCCAGAAGG + Intergenic
1085558243 11:77445282-77445304 TCTCAGTTCTAGAGGCCAGAAGG - Intronic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1087727771 11:101741761-101741783 CAGCTGAGGCAGAGGCCAGATGG - Intronic
1088423682 11:109676539-109676561 CATCTGCTTCACAGGTCAGAAGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089900928 11:121984061-121984083 AATCTGTTCCTGAGGCTACAGGG + Intergenic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1097130262 12:56806319-56806341 GACCTGCTCCAGAGTCCAGAAGG + Intergenic
1100287487 12:93181413-93181435 CATCCCTTCCAGACACCAGAGGG + Intergenic
1100614634 12:96221481-96221503 AATCTGCTCCTGAGGGCAGAAGG - Intronic
1101547647 12:105731656-105731678 CATATGATCCAGAAGCCAGCAGG - Intergenic
1101841654 12:108331836-108331858 CATCTCTTCCGGAGGCCCTAGGG - Intronic
1103966108 12:124640736-124640758 CATCTGCTCCAGAAGGGAGAGGG + Intergenic
1104450436 12:128864442-128864464 CATCTGCTCAAGACGCCAAAGGG + Intronic
1104939568 12:132388585-132388607 CCTCTATTCCGGAGGCCTGAGGG - Intergenic
1106066334 13:26355054-26355076 CATCTTTGCGAGAGACCAGATGG - Intronic
1106135209 13:26968473-26968495 CATCTGTTGGAGAAGCAAGATGG - Intergenic
1107373960 13:39782179-39782201 GCTCTTTTCAAGAGGCCAGAGGG + Intronic
1107734230 13:43379419-43379441 CATGTGTTCAAGAAGGCAGAAGG + Intronic
1111084477 13:83356840-83356862 CATATTTTCCATAGGCCATATGG - Intergenic
1114083574 14:19220820-19220842 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1117465101 14:55985130-55985152 CATCTGGTTCAGAGTCCACATGG - Intergenic
1117638668 14:57774420-57774442 CAACTGGTGCAGAGTCCAGAGGG + Intronic
1120492921 14:85199656-85199678 CATTTGGTCAACAGGCCAGAGGG - Intergenic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1202895185 14_GL000194v1_random:2589-2611 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1125531793 15:40418380-40418402 AACCTCATCCAGAGGCCAGAGGG - Exonic
1128619717 15:69138388-69138410 CATCTGTAGCAGACGCCAGCTGG - Intergenic
1129119481 15:73387298-73387320 CATCTGTACCCAAGGCCAAATGG + Intergenic
1129557732 15:76530527-76530549 TATCTGTTCCAGAGGCACTATGG + Intronic
1129818056 15:78573469-78573491 CCTCTGTGCCAGGTGCCAGAGGG - Intronic
1134103814 16:11471140-11471162 CATCTTTACCAGCAGCCAGATGG - Intronic
1134123098 16:11598490-11598512 TTTCTTTTCCTGAGGCCAGAAGG + Intronic
1135540661 16:23327784-23327806 CATCTTGTCATGAGGCCAGAAGG - Intronic
1135841633 16:25882156-25882178 CATGTGCTACAGAGTCCAGAGGG + Intronic
1136021779 16:27445120-27445142 CAACTCTACCAGAGGCCATATGG - Intronic
1136274312 16:29169472-29169494 CTTCTGTTCCAGATGCCAGCAGG - Intergenic
1137729912 16:50681617-50681639 CATCTGTTCAAGGGGCATGACGG - Intergenic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1141577560 16:84974066-84974088 CTTACCTTCCAGAGGCCAGATGG - Intergenic
1141648957 16:85382403-85382425 CCTCTGTTTCAGAGGCCACATGG + Intergenic
1141699766 16:85636953-85636975 CATCTGCGCCAGAGGGCAGCAGG + Intronic
1141923281 16:87150687-87150709 CATTTGTTCCAGATATCAGAGGG + Intronic
1142078597 16:88135118-88135140 CTTCTGTTCCAGACGCCAGCAGG - Intergenic
1142899624 17:3004044-3004066 CACCTGGGACAGAGGCCAGAGGG - Intronic
1142933500 17:3308455-3308477 AAGCTGTTTCAGAGCCCAGAGGG - Intergenic
1143171171 17:4931483-4931505 CATGTGTCACAGAGGCCAAAAGG + Intergenic
1144301266 17:13924477-13924499 CATCTGTTGGAGGGGCAAGAGGG - Intergenic
1145774879 17:27520819-27520841 CATTTGTCCCAGTGGCCAAAAGG + Intronic
1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG + Intronic
1149422007 17:56520509-56520531 CATCATTGGCAGAGGCCAGAAGG + Intergenic
1149651172 17:58277524-58277546 CTTGTCTTCCAGAGTCCAGAAGG + Intronic
1150934304 17:69618490-69618512 CATCTTGTCCAGAGGCCTCATGG - Intergenic
1151053225 17:71003615-71003637 GATCTGTTCCAGAAGCCTAAAGG - Intergenic
1152083739 17:78204988-78205010 TTTCTGCTCCACAGGCCAGAGGG - Intronic
1152180989 17:78821756-78821778 CAACTGCTCCAGTGGCCAGGCGG + Intronic
1152567160 17:81105435-81105457 CAGCTCTTCCACATGCCAGACGG + Intronic
1152626837 17:81391672-81391694 TATCTGCTCCCCAGGCCAGAGGG + Intergenic
1152760758 17:82105951-82105973 CCTCTGCTCCAAAGGCCAGCAGG - Intronic
1153651023 18:7240410-7240432 CAGCTTCTCCAGAGGTCAGATGG - Intergenic
1154016620 18:10624513-10624535 TATCTGTTCGAGATGCCTGATGG + Intergenic
1154188895 18:12211147-12211169 TATCTGTTCGAGATGCCTGATGG - Intergenic
1154465225 18:14637622-14637644 CATCAGCTGCAGTGGCCAGAGGG + Intergenic
1154500253 18:14992482-14992504 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1155400982 18:25438692-25438714 CATCAGTTTCACAGGCCAGTGGG - Intergenic
1157108996 18:44801910-44801932 GATCATTTCCAGTGGCCAGATGG - Intronic
1157518891 18:48331074-48331096 CATTTGTCCCGGGGGCCAGAAGG + Intronic
1157598205 18:48876523-48876545 TCTCTGTTTCAGAGGCCAGAGGG - Intergenic
1157598218 18:48876593-48876615 CTCCTGTTTCAGAGGCCAGAGGG - Intergenic
1159078943 18:63713828-63713850 CATCTGTTCCAGAAGTGAGAAGG + Intronic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1160843147 19:1155349-1155371 CTCCTGTCCCAGAGACCAGATGG + Intronic
1161455197 19:4366442-4366464 CCTCTGACACAGAGGCCAGAGGG + Intronic
1161845664 19:6710692-6710714 GATCGGTGCCAGCGGCCAGAGGG - Exonic
1162864897 19:13538321-13538343 CATCTGCTCTCGTGGCCAGAGGG - Intronic
1163095813 19:15056176-15056198 CTTCTGTTCCCAAGGCCAAATGG + Exonic
1166740908 19:45114318-45114340 CATGTGTTCCAGAGAGCAGGTGG - Intronic
1166883116 19:45940827-45940849 CAGCTGTCCCAGAAGCCGGAGGG - Exonic
1168709265 19:58489141-58489163 CATCTGGTCCCCAGGCAAGAAGG - Intronic
925777322 2:7347914-7347936 CATCTGTGCAGGAGGCAAGAGGG + Intergenic
926503682 2:13684598-13684620 TATCTGTTCCCCAGGCAAGAGGG + Intergenic
926953675 2:18271548-18271570 CACCTGCTCCAGGGGCCTGAAGG + Intronic
927212426 2:20646972-20646994 CAGCTGCTCCAGAGCCCAGGTGG + Intronic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
930942966 2:57035797-57035819 CATATGTTCCAGTGGCAACAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931925994 2:67073231-67073253 CATCTGTTGGAGGGGCCATATGG - Intergenic
933544816 2:83696452-83696474 CATCTGTTCTAAAGGGAAGAAGG - Intergenic
934934104 2:98452181-98452203 CCTTTGCTCCACAGGCCAGAGGG - Intronic
935711384 2:105902136-105902158 CAACTGATGCAGAGCCCAGAGGG - Intergenic
935720493 2:105974848-105974870 CCTCTGTACCTGAGCCCAGAAGG + Intergenic
935882819 2:107583400-107583422 CATGTGCTACAGAGGCAAGAAGG + Intergenic
936394760 2:112116440-112116462 CATATGTTCCAGAGAAAAGAGGG - Exonic
938493014 2:131775813-131775835 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
938499458 2:131822828-131822850 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
940278078 2:151960587-151960609 CTTCTGTTCCAGAGACTGGAGGG + Intronic
940339381 2:152563865-152563887 AAGCTGCTCCAGAGGCAAGAGGG - Intronic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
940488444 2:154326218-154326240 CATTTATTACAGAGGCCAGAAGG - Intronic
940653157 2:156457425-156457447 TACCTGTTACAGAGGTCAGAAGG - Intronic
943400984 2:187410691-187410713 CATCAGTTCCACAGCCCACAGGG + Intronic
945024962 2:205611633-205611655 GCTCATTTCCAGAGGCCAGAAGG - Intronic
945027467 2:205632731-205632753 CAACTTTTCCACAGTCCAGAGGG - Intergenic
946615991 2:221510758-221510780 GATCTGTTCTAAAGGCAAGAAGG - Intronic
947821911 2:233078149-233078171 CATCGGCTGCTGAGGCCAGAAGG - Intronic
948330935 2:237164637-237164659 GAACTGTTCCAGAAACCAGACGG - Intergenic
948680727 2:239632896-239632918 CATCTTTTCCAGGGAGCAGATGG - Intergenic
948871263 2:240799392-240799414 CAGCTCTTCCAGAGGCTACAGGG + Intronic
948887854 2:240892923-240892945 CAACTGAGGCAGAGGCCAGAGGG - Intronic
1169113126 20:3045935-3045957 CTTCGGTTCCAGAGGCCACACGG + Exonic
1169600122 20:7248952-7248974 CATCTGTTCCTGAAGGCTGATGG + Intergenic
1169778286 20:9280246-9280268 TCTCCTTTCCAGAGGCCAGAAGG - Intronic
1171243229 20:23587941-23587963 TGTGGGTTCCAGAGGCCAGATGG - Intergenic
1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG + Intronic
1173848543 20:46203120-46203142 CAGCTGTTCCTAAGGCCATAGGG + Intronic
1175428690 20:58888537-58888559 CCTCTGTTCCAGAGCCCCCAGGG + Intronic
1175812164 20:61864254-61864276 CGTCAGCTCCAGAGGCCAGGAGG - Intronic
1176614887 21:9018576-9018598 CAGCTGATCCAGTGCCCAGAAGG + Intergenic
1177106538 21:16963217-16963239 CATCTGTTGAAGAGGTCATATGG + Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1178721422 21:35013696-35013718 CATCTGTTTCAAAGGCTACAAGG - Intronic
1180294402 22:10872447-10872469 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
1180497208 22:15901861-15901883 CAGCTGATCCAGTGCCCAGAAGG - Intergenic
1182557249 22:31135917-31135939 CAGCTGTTCCAGAGACCCTAGGG - Exonic
1184414636 22:44345208-44345230 CCTCTGCTCTAAAGGCCAGAGGG - Intergenic
1184788006 22:46681074-46681096 GACCTGTTGCAGAGGACAGAGGG - Intergenic
1184913869 22:47553630-47553652 TCACTGTTCTAGAGGCCAGAAGG - Intergenic
1185011620 22:48317762-48317784 CATCTTTTGGAGAAGCCAGAGGG - Intergenic
1185060194 22:48602641-48602663 TCTCTGTACCAGAGGCCACATGG - Intronic
949193095 3:1273025-1273047 GCTCTGTTCCAAAGGCCAGCAGG - Intronic
950884700 3:16353225-16353247 AATCTTTCCCAGAGGCCAAAAGG + Intronic
952194230 3:31055975-31055997 CATCTGCTCCAGCTGCCAGAAGG - Intergenic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
953454168 3:43029036-43029058 CGTGGGTGCCAGAGGCCAGAGGG + Intronic
953534863 3:43769811-43769833 CATCTGTTCCCCAGCCCGGAAGG - Intergenic
953679504 3:45028927-45028949 CATCTGTTCTTGGGGCCACATGG + Intronic
954107248 3:48415977-48415999 CATCTGCTCCAGGGGAAAGATGG - Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
954885462 3:53869621-53869643 CATCTGGTCCAGGGAGCAGAAGG + Intronic
954960842 3:54563510-54563532 CACCTGTTCCAAAGGCATGATGG - Intronic
959465719 3:106684216-106684238 TATCTGTTCCAGTTACCAGATGG - Intergenic
961842738 3:129730967-129730989 AATCTGTTCCAGAAAGCAGAAGG + Intronic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
962347136 3:134626395-134626417 GATGTGTGCCTGAGGCCAGAGGG - Intronic
962462215 3:135624872-135624894 CACCTGTGCCAGAGGCCACATGG + Intergenic
962476927 3:135763126-135763148 TATCTGCCCCAGCGGCCAGAGGG + Intergenic
964432881 3:156624211-156624233 TAAGTGTTGCAGAGGCCAGATGG - Intergenic
965591019 3:170359636-170359658 AATTTGCTCCAGAGGCCAAAGGG - Exonic
965610353 3:170537095-170537117 CATTTGTTACAGCAGCCAGAGGG - Intronic
967267098 3:187700413-187700435 CAGCTCTTCCTGAGGCCAGCTGG + Intronic
968833812 4:2948167-2948189 CATGTGTGCCTCAGGCCAGATGG - Intronic
971437052 4:26638759-26638781 TACCTTTTCCAGAGGCCAGTTGG + Exonic
974309876 4:60191476-60191498 CATCTTTTTCAAAGGTCAGATGG - Intergenic
975095763 4:70454510-70454532 CATCTGTTGCAGTGGTCATATGG - Intronic
975512556 4:75209836-75209858 TATTTGTTCCACAAGCCAGAAGG + Intergenic
977422834 4:96825000-96825022 CTTCTGTACCAAAGCCCAGATGG - Intergenic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
983562643 4:169116424-169116446 CAGCTGCTGCACAGGCCAGAGGG + Exonic
987119738 5:14755797-14755819 CATCAGTTACACACGCCAGAAGG + Intronic
994506764 5:100652251-100652273 TATCTGTTTCAGAAGACAGATGG - Intergenic
997207806 5:132060236-132060258 CATCTGTTCCAGTGGCCTCCTGG + Intergenic
997667967 5:135647633-135647655 CATGTGTCCCAGAGCCCAGGAGG - Intergenic
997719514 5:136066386-136066408 CAACTATACCAGAGGCCAGGAGG + Intergenic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
999658471 5:153833765-153833787 CATCTGTGCCAGAGGGGAAAGGG + Intergenic
1000341183 5:160278511-160278533 CATATGCTGCAGAGACCAGAGGG - Intronic
1002785812 6:399041-399063 CATCTACTCCAGACCCCAGAGGG - Intronic
1003215540 6:4106122-4106144 CATCTCTCCCAGAGTTCAGAGGG - Intronic
1007106404 6:39286185-39286207 CCTCTGTTTCCCAGGCCAGAGGG + Intergenic
1007748551 6:44057850-44057872 CACCTGTACCAGAGGCCTGGTGG + Intergenic
1011801256 6:91018773-91018795 CAACAGTTCCAGAGGCTTGAAGG + Intergenic
1013641888 6:112091827-112091849 TATATGTTCAAGAGGACAGAAGG + Intronic
1013992179 6:116265883-116265905 CATCTGATGCAGAACCCAGAGGG - Intronic
1015479320 6:133690547-133690569 CATCTGTCTCAGACCCCAGAGGG - Intergenic
1017888995 6:158624188-158624210 GGTCTGTTCCAGAGCCCACATGG - Intronic
1018178610 6:161200740-161200762 CATCTGTTCCTGAAGCCATACGG + Intronic
1019142746 6:169958524-169958546 CATTCGTTACAGTGGCCAGAAGG + Intergenic
1019825480 7:3280712-3280734 CATCTGTTAGAGAGGCCAAAAGG - Intergenic
1021796267 7:24257523-24257545 CATCTTGTCCTGAGGCCAGATGG + Intergenic
1022419892 7:30210463-30210485 AGTCTGTCCCAGTGGCCAGATGG + Intergenic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1028347341 7:89798787-89798809 CAGCTGGTACAGAGCCCAGAGGG - Intergenic
1028404675 7:90462751-90462773 GATCTGATCCAGTGTCCAGATGG + Intronic
1028645144 7:93087097-93087119 CATCTGTTTCACAGGGCATAAGG + Intergenic
1030086508 7:105820186-105820208 CATCTGTTCCTGATGCCTGTAGG + Intronic
1031079387 7:117243399-117243421 CATATGTTCCAGAGGGGAGAGGG - Intergenic
1032054688 7:128674965-128674987 CCTATGTTCCCAAGGCCAGAGGG - Intronic
1032543637 7:132724545-132724567 CATTTGTTCCTGAGGGCAGTAGG - Intronic
1033244241 7:139704949-139704971 CACCTCTTCCTGAGTCCAGAGGG - Intronic
1033861397 7:145632423-145632445 CTTCTGTTCTAGAGGGCAGTAGG + Intergenic
1036110724 8:5898247-5898269 CATGTGTTCAAGAAGCTAGAGGG + Intergenic
1036754392 8:11462790-11462812 CATCTGCTCCAGAGGCAGCAGGG + Intronic
1038536850 8:28359729-28359751 CTTCTGCTCCAGCAGCCAGACGG + Exonic
1038919597 8:32068109-32068131 CATTTGTTCTACAGGTCAGAAGG + Intronic
1039387145 8:37146127-37146149 CGTCTTTTCCAAATGCCAGAAGG - Intergenic
1039408500 8:37332629-37332651 CATCTGTTACAGCAGCCACAGGG - Intergenic
1039508664 8:38071398-38071420 CAGCTGCTTCAGCGGCCAGATGG + Intergenic
1041029106 8:53718112-53718134 CATCCCTTCCAGAGGCCTGAGGG + Intronic
1041578927 8:59434200-59434222 CATCTGTTTCTGTGGCAAGAAGG + Intergenic
1044019885 8:87093081-87093103 CATCTATTCTAGAAGTCAGAGGG - Intronic
1045328014 8:101131234-101131256 CATCTGTGGCAGATGGCAGAAGG - Intergenic
1045866237 8:106868849-106868871 GATCTGTTCCAGAGTTCATATGG - Intergenic
1047512811 8:125528703-125528725 CATGGGTTCCTGAGGCAAGATGG - Intergenic
1048548012 8:135404964-135404986 CATCAGTGCCAAAGTCCAGAGGG + Intergenic
1049807234 8:144546603-144546625 CATCAGCTCCAGGAGCCAGATGG + Intronic
1049961517 9:742264-742286 CATCAGCCCCACAGGCCAGAAGG - Exonic
1051840153 9:21387255-21387277 CATCTGCACCATAGGCCAAATGG - Intergenic
1056291745 9:85150483-85150505 CAACAGCTTCAGAGGCCAGAAGG + Intergenic
1056542182 9:87581643-87581665 CTTATCTTCCACAGGCCAGAAGG - Intronic
1056580174 9:87884454-87884476 CATCTGTGTCCGAGGCCACATGG - Intronic
1060818852 9:126650308-126650330 CATCTTTTCTAGGGGCCAGAGGG + Intronic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1062536572 9:137023703-137023725 CAGCTGTTCCTGAGGCCGGCAGG + Intronic
1062644632 9:137541230-137541252 CATCTAGTCCAAAGGCCAGAGGG + Intronic
1186172763 X:6894748-6894770 CATCTGTTACAGAGGCTACTTGG + Intergenic
1188700906 X:33261785-33261807 CAGCTATTCCAGGGGCCAGATGG + Intronic
1191207973 X:57854028-57854050 CATCTGGTGCAGAGCCCAGGGGG - Intergenic
1193331037 X:80236270-80236292 ATTCTGTTCCAGAGGCCATTTGG + Intergenic
1193907419 X:87260390-87260412 TATCTCTTCCAGAAGCCAAAGGG - Intergenic
1194007761 X:88518224-88518246 CAAGTGTTCCAGAGGCAAAAAGG + Intergenic
1194554084 X:95336673-95336695 CATCTTCTCCACAGGGCAGAGGG + Intergenic
1198280106 X:135133411-135133433 CATCTGTTACAGAGGACTGGAGG + Intergenic
1198290852 X:135239103-135239125 CATCTGTTACAGAGGACTGGAGG - Intergenic
1198440383 X:136657642-136657664 CATCTGATCCAGAAGAGAGAAGG - Intronic
1199965118 X:152813290-152813312 TATCTGTTCCTGACCCCAGATGG - Intergenic
1202018178 Y:20434462-20434484 AACCAGTTCCAGAGACCAGAAGG - Intergenic