ID: 1178549393

View in Genome Browser
Species Human (GRCh38)
Location 21:33523363-33523385
Sequence GCCACAGTGTTAGTTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178549393 Original CRISPR GCCACAGTGTTAGTTGCTAC TGG (reversed) Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
906826943 1:48992376-48992398 GCCACAGGGATATTTGCTCCAGG - Intronic
915190411 1:154145877-154145899 GCCAGTGTGCTTGTTGCTACTGG - Intronic
917590823 1:176475217-176475239 GCCACACTGTCATTTGCTCCTGG + Intronic
918590988 1:186240921-186240943 CCCACAGTGTGAGCAGCTACAGG + Intergenic
923471823 1:234297903-234297925 GCCACAGTATGAGTAGCTATAGG - Intronic
924629310 1:245721886-245721908 GCCCCAGTGATAGTGGCCACAGG + Intergenic
1066564591 10:36707763-36707785 GCCCCAGTGTTAATTGGTACTGG + Intergenic
1070948227 10:80410348-80410370 GAGGCAGTGTTAGCTGCTACAGG + Intronic
1078499141 11:11852188-11852210 GCCACAGTAATAATTGCTGCAGG - Intronic
1080317831 11:30970402-30970424 GCCACAGTGGTAGCTGCAAGTGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1087022655 11:93618696-93618718 GCCATAGGGTTAGTTCCTTCTGG + Intergenic
1089043829 11:115481321-115481343 GCCACAGTGTCAAATGCTACAGG - Intronic
1091183202 11:133626096-133626118 GCCACAGTGTTGGTAGGTTCTGG - Intergenic
1098490108 12:71065684-71065706 GCCACAGTAATAATTGCTGCAGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1100784511 12:98064890-98064912 TGCACAGTGTGAGTTGTTACTGG + Intergenic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1107491040 13:40880043-40880065 GCCACAGTGTTAGTGGTGAAAGG - Intergenic
1108448164 13:50529674-50529696 GACTCTGTGCTAGTTGCTACTGG + Intronic
1110736358 13:78941586-78941608 GCAACAGTGTTGGTTTCTTCTGG - Intergenic
1111508128 13:89222085-89222107 ACAACAGTGTTATTTTCTACAGG + Intergenic
1112468570 13:99667490-99667512 GCCACAGAGTTAGATGCAAGTGG - Intronic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1120061809 14:79992281-79992303 TTCACAGTGTTAATTGCTTCAGG + Intergenic
1120405845 14:84092152-84092174 GCCACAGGGTGAGTAGCTCCAGG - Intergenic
1121088475 14:91164750-91164772 GTCACAGTGGTGGTGGCTACAGG - Intronic
1121622913 14:95362622-95362644 GCCCCAGTGGGAGATGCTACAGG - Intergenic
1121759652 14:96434501-96434523 GTCACAGTGGTGGTGGCTACAGG - Intronic
1131507037 15:93028374-93028396 GACACAGTGTTATTTCCTTCAGG - Intergenic
1135611359 16:23870614-23870636 GCCAGAGTGGTAGCTGCTTCAGG + Intronic
1138710651 16:58966956-58966978 GCCACAGTGCTAATTAATACGGG + Intergenic
1139809984 16:69606553-69606575 GCCACAGTTTTCCTTTCTACAGG - Intronic
1140554494 16:75905954-75905976 GACTTAGTGTTAGTTGCTATTGG + Intergenic
1140656802 16:77149448-77149470 GTCAAAGTGTTAGATGTTACTGG + Intergenic
1141594083 16:85086909-85086931 GCCACAGTGAGAGTTGCTGGTGG + Intronic
1143097623 17:4486770-4486792 ACTACAGTGTCAGTTTCTACAGG - Intronic
1143388702 17:6547511-6547533 GGCACAGTGGCAGGTGCTACGGG - Intronic
1144263609 17:13547168-13547190 GACATAGTGTTAGATGCTATGGG - Intronic
1149928910 17:60730005-60730027 ACCAAAGTGTTAGTTGCAAATGG + Intronic
1150797316 17:68248389-68248411 CCCACAGTGCGAGTTGCTATAGG + Exonic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153463226 18:5360475-5360497 GACACTGGGTTAGTTACTACTGG - Intergenic
1155250242 18:23947222-23947244 GCCACAGCGTTAATTGCACCAGG + Intronic
1156242811 18:35270001-35270023 CCCACAGTGTTAGCAGATACTGG - Intronic
1159079330 18:63719013-63719035 GTCACAGAGTTAGTGTCTACTGG - Intronic
1168289625 19:55351307-55351329 GCCACATGGTTAGTAGCTTCAGG + Intronic
931681576 2:64753564-64753586 GCCCCTGTGTCAGTTGTTACTGG + Intergenic
935733997 2:106091685-106091707 ACCACTGTGTTAGTTGGTTCAGG + Intergenic
938648158 2:133352323-133352345 GGCACAGTGTCAGATGCTAGAGG - Intronic
942386978 2:175452893-175452915 GCCACAGTCTTTGTTGCCAAGGG - Intergenic
1176876188 21:14131265-14131287 GCCCCAGTGCTAGTTGGTCCTGG - Intronic
1177939596 21:27392224-27392246 GACACAGTGGTACTGGCTACAGG - Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1178663580 21:34526966-34526988 GACAAAGTGTAAGTTTCTACTGG + Intronic
1178750112 21:35294716-35294738 GCCACAGGGAAACTTGCTACTGG - Intronic
1179052138 21:37897057-37897079 GCCACAGTGTTTGTTCCTACAGG - Intronic
1181363003 22:22353201-22353223 GCATCAGTGTTGGTAGCTACAGG + Intergenic
1183274649 22:36885984-36886006 CCCAAAGTGTGAGCTGCTACGGG + Intergenic
1185194941 22:49463235-49463257 ACCACAGTCTTAATTGCTGCAGG - Intronic
952974448 3:38682049-38682071 GCCCCAGTGGTATGTGCTACAGG + Intergenic
955951507 3:64247092-64247114 GCCACAGTGCTGGTAGCAACTGG + Intronic
956649701 3:71492774-71492796 GTCACAGTGTTCATTACTACAGG + Intronic
961219874 3:125191364-125191386 TTCACAGTGTGAGTTACTACTGG - Intronic
961514575 3:127424726-127424748 GCCACAGTGTTGCTTCCTCCTGG + Intergenic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
964638758 3:158885947-158885969 CCCACAGTGTTAGCTGCCACTGG - Intergenic
964741940 3:159975425-159975447 GAGACAGTGTTAGATCCTACAGG - Intergenic
966063927 3:175793806-175793828 GTCACTGTGTTAGTTGCTTAGGG - Intronic
967856348 3:194120397-194120419 ACCACAATAATAGTTGCTACAGG + Intergenic
968135954 3:196219731-196219753 GCCACACTGGAAGGTGCTACTGG + Intronic
971024137 4:22571451-22571473 GCCACAGTGGCAGTTGCTGTTGG + Intergenic
976171590 4:82310456-82310478 GCCACAGTGTTACTGGCTTTGGG - Intergenic
977628860 4:99219197-99219219 TCTACAGTGAAAGTTGCTACAGG - Exonic
977719666 4:100224487-100224509 CCCACAGTCTTAGCTGCTGCTGG - Intergenic
978712909 4:111807079-111807101 GCTACAGTATTAGTTGAAACCGG + Intergenic
981409834 4:144416920-144416942 GACACAGTGTTAGTAACTAGAGG + Intergenic
982369337 4:154617293-154617315 GCCACATTGGTATCTGCTACTGG + Intergenic
987726780 5:21712553-21712575 ATCACAGTGTTGGTTGCTAGAGG - Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
998304344 5:141058741-141058763 GCCACAATATTAATTGCCACAGG - Intergenic
1003375991 6:5578286-5578308 GCCACAGTCTAAGCTGCTATGGG - Intronic
1011282815 6:85693675-85693697 TCCACAGTGTTTTATGCTACAGG + Intergenic
1018707830 6:166475799-166475821 GCCCCCGTGTGAGTTGCTCCAGG - Intronic
1021802338 7:24319467-24319489 GCCAAAGTTTTTGTTGCCACTGG + Intergenic
1023301899 7:38782193-38782215 TCCACAGTGTGAGTTGCCAGGGG + Intronic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1028339137 7:89695781-89695803 GCCATAGTGGTAGTGGCCACAGG + Intergenic
1030930028 7:115511338-115511360 GCCACAGTAATAATTGCTGCAGG + Intergenic
1031243151 7:119271196-119271218 GCTACAGTGGTAGTTTCTCCTGG - Intergenic
1033119646 7:138656099-138656121 GCCTCAGTGTTAATGGCTGCTGG - Intronic
1033418720 7:141186777-141186799 GCCACATTGTTAGTAGCCACTGG - Intronic
1033758319 7:144415433-144415455 ACCTGAGTGTTAGTTGCTACAGG + Intergenic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1039266912 8:35835001-35835023 GCCACAGTGTTAATGGCTGCTGG - Intergenic
1043791774 8:84477290-84477312 GCAACAGCGTTAGATGCTAAAGG - Intronic
1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG + Intronic
1055687237 9:78789802-78789824 GACACTGTGATAGTTGCTGCAGG + Intergenic
1056070763 9:82984343-82984365 GCCACATTGTGAGTGGCTAGTGG + Intronic
1058937468 9:109782138-109782160 ACCCCAGTGTTAGCAGCTACTGG - Intronic
1059230584 9:112717902-112717924 GCCGCCGTCTTTGTTGCTACAGG - Intronic
1061508103 9:131043742-131043764 CTCACAGTGGTAATTGCTACAGG + Intronic
1187215619 X:17273151-17273173 ACCACAGTAATAGTTGTTACCGG - Intergenic
1187583256 X:20631931-20631953 GCTACAGTCTTAGTTTCTACAGG + Intergenic
1188244625 X:27824850-27824872 GGCACAGTGTTAGTGTGTACTGG - Intergenic
1190030748 X:46970511-46970533 GCCACAGTGTTTGGTGCACCTGG + Intronic
1190283048 X:48943930-48943952 GACACATTGTCAGGTGCTACAGG - Intronic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1197034212 X:121854504-121854526 GCAACAGTGCTGGTGGCTACAGG - Intergenic
1198894884 X:141442755-141442777 GCCTGAGTGTTGGTTGCTACAGG + Intergenic
1200163517 X:154020730-154020752 GCCACAGTGGTGGTGGCTTCAGG - Intergenic
1202036793 Y:20644519-20644541 GCAACAGTACTAGTAGCTACGGG + Intergenic