ID: 1178551661

View in Genome Browser
Species Human (GRCh38)
Location 21:33544601-33544623
Sequence CCAGCTAATACGTTGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178551655_1178551661 30 Left 1178551655 21:33544548-33544570 CCCCCCATGTATTGTGTGATATG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG 0: 1
1: 0
2: 2
3: 3
4: 45
1178551659_1178551661 26 Left 1178551659 21:33544552-33544574 CCATGTATTGTGTGATATGTGAT 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG 0: 1
1: 0
2: 2
3: 3
4: 45
1178551658_1178551661 27 Left 1178551658 21:33544551-33544573 CCCATGTATTGTGTGATATGTGA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG 0: 1
1: 0
2: 2
3: 3
4: 45
1178551657_1178551661 28 Left 1178551657 21:33544550-33544572 CCCCATGTATTGTGTGATATGTG 0: 1
1: 2
2: 1
3: 7
4: 133
Right 1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG 0: 1
1: 0
2: 2
3: 3
4: 45
1178551656_1178551661 29 Left 1178551656 21:33544549-33544571 CCCCCATGTATTGTGTGATATGT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG 0: 1
1: 0
2: 2
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178551661 Original CRISPR CCAGCTAATACGTTGTGAAC AGG Intronic
907614069 1:55905963-55905985 ACAGCTAATAAGTGGTGGACAGG - Intergenic
1074974299 10:118567778-118567800 CCAGATAATACAATGTGACCTGG - Intergenic
1076892911 10:133293561-133293583 CCAGCTACTCCGCTGTGACCAGG - Exonic
1079254866 11:18819248-18819270 CCAGCCACTACGTTGTGACTGGG - Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1095146539 12:38735488-38735510 AGAGCTAATACGTTGTTATCTGG - Intronic
1097121970 12:56740606-56740628 CCAGCTAATATTTTGTAGACAGG - Intronic
1098366910 12:69713118-69713140 CCATCTAGTGCATTGTGAACTGG - Intergenic
1102941469 12:116946432-116946454 CCAGCTAATTCGTTTTGTGCGGG + Intronic
1103833295 12:123797964-123797986 CCAGATAATACGTTTTGAACAGG + Intronic
1110413106 13:75224632-75224654 CCACCGACTACGTTGTCAACAGG + Intergenic
1111164222 13:84436966-84436988 CCAGCTAAGATGTGCTGAACTGG + Intergenic
1126782850 15:52153219-52153241 CCAGCTACCATGTTGTGAGCAGG + Intronic
1127848120 15:62889165-62889187 CCACCTAATAGGTTCTGAAATGG + Intergenic
1138431662 16:56972885-56972907 CCAGCCCATGGGTTGTGAACAGG - Intronic
1138946438 16:61856523-61856545 CCAGCTAATACCCTGTGATCTGG - Intronic
1144260836 17:13518784-13518806 CCAGCTAATTCCTTCTGCACAGG + Intronic
1153366190 18:4259146-4259168 CCAGATAGTACGTAGTTAACAGG + Intronic
1158580962 18:58682414-58682436 CCAACCAATGCGTTGAGAACAGG - Intronic
1160103027 18:75941291-75941313 ACAGCTAATAACTTGTGAAGAGG - Intergenic
1167645541 19:50703304-50703326 CCAGCTAACATGTGGTGCACCGG + Intronic
930621349 2:53647000-53647022 CCAGATAATACCATGTGTACAGG - Intronic
948363380 2:237438197-237438219 CCTGCTTTCACGTTGTGAACTGG - Intergenic
1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG + Intronic
951277426 3:20705540-20705562 ACAGCTAATAACTTGTAAACAGG - Intergenic
953938115 3:47064375-47064397 AGTGCTAATACCTTGTGAACTGG - Intronic
957013031 3:75029590-75029612 CAAGCTACTATGTTGTGAATTGG - Intergenic
972257875 4:37378210-37378232 CCAGTTAATATTTTGTGAAGTGG - Intronic
977049031 4:92103387-92103409 CCAGCTAATTCATTGTGAACAGG - Intergenic
977781579 4:100986803-100986825 CTAGCTAATGAGTTGGGAACTGG - Intergenic
982395348 4:154909922-154909944 CCAGCAAATATGTATTGAACTGG - Intergenic
984133976 4:175913409-175913431 CCAGCTACTACTTTGGGAAAGGG - Intronic
991100666 5:62789078-62789100 CAAGCTAATACCTTGTAAAGAGG + Intergenic
1003344613 6:5255748-5255770 CCAGCTAATTCTTTGTTAATGGG + Intronic
1003344649 6:5256039-5256061 CCAGCTAATTCTTTGTTAATGGG - Intronic
1005458912 6:26048994-26049016 CCAGCTAATCCATTGTGTTCAGG - Intergenic
1010889879 6:81293491-81293513 CCAGCTAACACCTAGAGAACTGG - Intergenic
1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG + Intergenic
1023894626 7:44422127-44422149 ACAGCTAAAACGGTGTTAACAGG + Intronic
1026285118 7:68956004-68956026 CCAGGTAATGTGTTGTGAAAAGG - Intergenic
1031255904 7:119448714-119448736 CCTGTTATTATGTTGTGAACTGG + Intergenic
1032698739 7:134360206-134360228 TCAGCTAATATGTCGTGACCTGG + Intergenic
1033883406 7:145915803-145915825 CCAGCTAATAGGATGTGGATAGG - Intergenic
1039252605 8:35683332-35683354 CAAGCTAATAAGTTGGGAGCAGG - Intronic
1039883456 8:41641711-41641733 CCAGCTACTACTTTGTGACGTGG + Intergenic
1042372262 8:68005370-68005392 CCAGCTACTTCGTGGAGAACTGG - Intronic
1045805297 8:106152883-106152905 CCAGCTAATACCTTATGATTTGG + Intergenic
1046377256 8:113400212-113400234 CCAGCTATAAAGTTGTGATCTGG + Intronic
1047268146 8:123327960-123327982 CAAGCTACTAAGTAGTGAACTGG + Intronic
1047424120 8:124729894-124729916 ACAGTTAGTAGGTTGTGAACTGG - Intergenic
1059749470 9:117234379-117234401 CCAGCTAATCCCTCCTGAACCGG + Intronic