ID: 1178552498

View in Genome Browser
Species Human (GRCh38)
Location 21:33552512-33552534
Sequence CGTCATACTCTGCTGCTGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178552497_1178552498 -9 Left 1178552497 21:33552498-33552520 CCGGTCTATGATGTCGTCATACT 0: 1
1: 0
2: 1
3: 6
4: 40
Right 1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1178552492_1178552498 29 Left 1178552492 21:33552460-33552482 CCAATGGCTGATCGATCTATGAT 0: 1
1: 0
2: 3
3: 1
4: 27
Right 1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1178552491_1178552498 30 Left 1178552491 21:33552459-33552481 CCCAATGGCTGATCGATCTATGA 0: 1
1: 0
2: 1
3: 6
4: 50
Right 1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1178552496_1178552498 4 Left 1178552496 21:33552485-33552507 CCATGGGTGCTGACCGGTCTATG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178552498 Original CRISPR CGTCATACTCTGCTGCTGAC CGG Exonic
903063293 1:20684789-20684811 CCCCATGCTCTGCTGCTTACCGG + Exonic
904174535 1:28617233-28617255 CGGCATAGTCTGTTGCTCACAGG - Intronic
909722619 1:78794062-78794084 TCTCATACTCTGCTTCTTACTGG - Intergenic
910114416 1:83716531-83716553 TGTCCAACTCTGCTGCTTACCGG - Intergenic
915587282 1:156850941-156850963 AGTCTTGCTCTGCAGCTGACAGG + Intronic
916278970 1:163027486-163027508 CTACATACTCTGCTGCTTCCTGG - Intergenic
920194441 1:204217517-204217539 CCTCAGACCCTGCTGCTGCCAGG - Intergenic
922107972 1:222528848-222528870 GGTCTTGCTCTGTTGCTGACTGG + Intronic
1063383786 10:5603328-5603350 CGTCAGATTCTGCTGCAGGCTGG + Intergenic
1068912202 10:62390133-62390155 ATTCTTACTCTGCTTCTGACTGG + Intronic
1073244712 10:102081557-102081579 GGTCCTACTCTGCAGCTGAGAGG - Intergenic
1077214071 11:1388045-1388067 CGTCTGACTCTGCTGCAGCCTGG + Intergenic
1080329388 11:31117958-31117980 CATCATACTCAGCTACTGACAGG - Intronic
1084680320 11:70662936-70662958 CGTAGGACTCTGCTGCTGCCCGG + Intronic
1091045065 11:132318050-132318072 TGTCTGACTCTGCTGCTGAGGGG - Intronic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG + Intergenic
1112560201 13:100506136-100506158 TTTCATGCTCTGCTGCTGCCAGG + Intronic
1113733498 13:112658852-112658874 TCACATATTCTGCTGCTGACAGG - Intronic
1114269897 14:21094240-21094262 CTTCAGACTCTGCTGCTGGGAGG - Intronic
1124270376 15:28275034-28275056 CTGCACCCTCTGCTGCTGACTGG - Intronic
1124406765 15:29399680-29399702 GGTAATAGTCTGCTGTTGACTGG + Intronic
1129930212 15:79404318-79404340 CATCAGCCTCTGCTGGTGACAGG + Intronic
1131569830 15:93523593-93523615 CCTCATAATAAGCTGCTGACTGG + Intergenic
1132770707 16:1561276-1561298 AGTCATTCTCTGCTTCTGAGAGG - Intronic
1134915569 16:18068052-18068074 AGTCATCCTCTGCTGCTTCCTGG - Intergenic
1141126617 16:81405046-81405068 CCTCACACCCCGCTGCTGACAGG + Intergenic
1144261571 17:13526980-13527002 CCACATACTTTGCTGCTGGCTGG + Intronic
1159308965 18:66683156-66683178 CCTCTTCCTCTGCTGCTGCCTGG - Intergenic
1161354528 19:3811408-3811430 CGTCCCGCTCTGCTGCCGACGGG + Intronic
1163783650 19:19263220-19263242 AGTCACACTCTGCTGTGGACTGG + Intergenic
1165446549 19:35860003-35860025 AGTCTCACTCTGCTGCTGAGTGG - Intronic
925361742 2:3284813-3284835 CCTCTGACTCTGCTGCTGGCGGG - Intronic
931207074 2:60158089-60158111 CTCCATACTCTGCATCTGACTGG + Intergenic
1173398496 20:42702985-42703007 GATCATACCCTGCTGCTGGCAGG - Intronic
1174378421 20:50141218-50141240 TCTCAGACTCTGCTGCTGCCTGG + Intronic
1177153372 21:17477103-17477125 GGTCTTAGTCTGCTGCAGACTGG - Intergenic
1177570435 21:22878914-22878936 CTTCATAGTCTGATGGTGACAGG + Intergenic
1177660318 21:24074232-24074254 TGTCATTCTTTGCTGCTGGCAGG + Intergenic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1183381433 22:37492322-37492344 GGCCATGCTCTGCTGCTCACTGG - Intronic
963746043 3:149126140-149126162 AGTGATACAATGCTGCTGACGGG + Intergenic
964052782 3:152417251-152417273 GGTCATAATCAGCTGCTTACTGG + Intronic
970057219 4:11988649-11988671 AGTCATTCTCTGCTGCAGCCAGG + Intergenic
975890504 4:79021540-79021562 CGTCATATCCAGCTGCTTACTGG - Intergenic
976583267 4:86765451-86765473 CATCAGACTCTGCTGCTCCCTGG - Exonic
980498835 4:133621894-133621916 TGTCATCCTTTGCTGCTGCCTGG - Intergenic
980514221 4:133832929-133832951 CGGCCTACTCTGCTGCTTAATGG - Intergenic
982326623 4:154135671-154135693 CGTCAGACTCTGCTGGGCACAGG - Intergenic
984208282 4:176813943-176813965 CGTCCTACTCTGCCTTTGACTGG - Intergenic
986002937 5:3644287-3644309 CGTTATCCCCTGCTGCTGAGGGG - Intergenic
988601646 5:32645487-32645509 CGTCATTCTCTGGTTTTGACTGG + Intergenic
992718813 5:79539172-79539194 CTTCATGCTTTGCTTCTGACAGG - Intergenic
995030973 5:107481122-107481144 AGTTAGACTCTCCTGCTGACAGG + Intronic
996219273 5:120909819-120909841 CATGATAGTCTGCTGCAGACTGG + Intergenic
1001924611 5:175627154-175627176 CCTGGTGCTCTGCTGCTGACTGG + Intergenic
1003861489 6:10326290-10326312 CTTCATAATCTGCTTCCGACGGG + Intergenic
1024563516 7:50663592-50663614 GGTCATACTGGACTGCTGACTGG + Intronic
1039581597 8:38671266-38671288 GTTCATACTCTCCTGCTAACGGG - Intergenic
1040919093 8:52597295-52597317 CGTCATACGCTACTGCTGGCGGG - Intergenic
1044386684 8:91597528-91597550 AACCATACTGTGCTGCTGACTGG - Intergenic
1047719741 8:127628718-127628740 GGTCATGGTCTGCAGCTGACTGG - Intergenic
1050508018 9:6367552-6367574 CCTCATACACTGCTGCTAAGAGG + Intergenic
1056887276 9:90455557-90455579 CCTCATATTTTGCTGCTTACTGG - Intergenic
1060805004 9:126569781-126569803 TGTTAGTCTCTGCTGCTGACAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1195146985 X:102027570-102027592 GGTGATACTTTGCTGATGACAGG - Intergenic
1195222549 X:102760335-102760357 CTTGCTTCTCTGCTGCTGACAGG + Intergenic
1200887108 Y:8281063-8281085 GGACAGACTCTGCTGCTGTCAGG - Intergenic