ID: 1178557985

View in Genome Browser
Species Human (GRCh38)
Location 21:33610552-33610574
Sequence TTATTTATAAATCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178557985_1178557990 4 Left 1178557985 21:33610552-33610574 CCATCCTCCTGATTTATAAATAA 0: 1
1: 1
2: 1
3: 32
4: 452
Right 1178557990 21:33610579-33610601 GAAGAAAAAGGCCATTTGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 348
1178557985_1178557989 -8 Left 1178557985 21:33610552-33610574 CCATCCTCCTGATTTATAAATAA 0: 1
1: 1
2: 1
3: 32
4: 452
Right 1178557989 21:33610567-33610589 ATAAATAAGGTAGAAGAAAAAGG 0: 1
1: 1
2: 13
3: 138
4: 1425
1178557985_1178557991 12 Left 1178557985 21:33610552-33610574 CCATCCTCCTGATTTATAAATAA 0: 1
1: 1
2: 1
3: 32
4: 452
Right 1178557991 21:33610587-33610609 AGGCCATTTGTGTGGTTTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178557985 Original CRISPR TTATTTATAAATCAGGAGGA TGG (reversed) Intronic
900865581 1:5266510-5266532 TTTCCTATAAATCAGGAGCATGG - Intergenic
901173425 1:7280644-7280666 CTATTTATTAAACAGGAAGAAGG - Intronic
901359038 1:8679731-8679753 GTATTTATAATACAGGATGATGG + Intronic
902975293 1:20083968-20083990 TTCTTTTAAAATCAAGAGGAAGG + Intronic
903097059 1:20986921-20986943 TTATTAATACACCAGAAGGATGG + Intronic
903405852 1:23095211-23095233 TCATTTTTAAAACAGGAGAATGG + Intronic
905336306 1:37247040-37247062 CTATTTATCAGCCAGGAGGAAGG + Intergenic
906137434 1:43509250-43509272 TTATTTACAAAACAGGTGGCAGG - Intergenic
906813595 1:48854236-48854258 TTATTTATGAATCAAGATCATGG - Intronic
907217946 1:52882191-52882213 TTATTTAGAAATAAGGAAGTTGG - Intronic
907391096 1:54158821-54158843 TAATTTTTAAGTCATGAGGAGGG - Intronic
907867847 1:58416095-58416117 TTATCTGTAAAACAAGAGGATGG - Intronic
908816033 1:68035488-68035510 TTCTTCATAAAGCAGTAGGAAGG + Intergenic
908893717 1:68875509-68875531 TAATTAATAAAACAGCAGGAGGG + Intergenic
909408552 1:75321400-75321422 TCATCTAGAAATCAGGAAGAGGG - Intronic
909410918 1:75350270-75350292 CCATCTATAAATCAGGAAGAGGG + Intronic
910083095 1:83365265-83365287 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
910587666 1:88897030-88897052 TTATTTAAAAATCAAAAAGATGG - Intergenic
911353918 1:96792455-96792477 CTATTTATTAGTCAGGAGTACGG - Intronic
911793788 1:102051976-102051998 TTATTTATCAATAAAGAGGTGGG + Intergenic
912374693 1:109200716-109200738 TAGTCTATAAAACAGGAGGATGG - Exonic
913719090 1:121573516-121573538 TTACTTATAAATTGGGAGGGTGG + Intergenic
914701591 1:150138946-150138968 TTATTGATAAGTCAGGATGTAGG - Intronic
915437664 1:155920953-155920975 TTATTTACAAAACAGGTGGCAGG - Intronic
916283249 1:163075768-163075790 ATATTTATAAACCAGCAGCAGGG + Exonic
916869623 1:168899042-168899064 TGATTTATGATTCAGGATGATGG - Intergenic
917390515 1:174531205-174531227 TTAGTTATAACACAGGAAGATGG + Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918291173 1:183109476-183109498 TTATTTAGTGATCAGGAGAATGG + Intronic
918471906 1:184883977-184883999 ATTTTTTTAAATCAGGAAGAAGG + Intronic
918798356 1:188936563-188936585 TTATGTATAAATCATGATAAAGG - Intergenic
919602992 1:199646151-199646173 TTATTTATTAAGTAGGAGAAAGG + Intergenic
922392434 1:225158968-225158990 TTATTTAAAAATCTCTAGGAGGG - Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922882050 1:228988441-228988463 TTATTTACAAAACAGGTGGTGGG + Intergenic
923585771 1:235268770-235268792 TTATTTAGAAATCAAGACGTGGG - Intronic
923784697 1:237055616-237055638 TCATATGGAAATCAGGAGGAAGG + Intronic
923954784 1:239004066-239004088 TTACTTATAAATTATGAGAAAGG - Intergenic
924013581 1:239694591-239694613 ATATTTTTAAATCAGAAGAAGGG - Intronic
1063287913 10:4710542-4710564 TTAGTGATAAAGCAGAAGGATGG - Intergenic
1063467583 10:6257448-6257470 TTATTTTTAAATCATGACGATGG + Intergenic
1063472746 10:6301366-6301388 TTATTTATAAGTAAGGGTGAAGG - Intergenic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1063937222 10:11090424-11090446 TTTTTTATTAATTGGGAGGAGGG - Intronic
1064013103 10:11751651-11751673 TTATATACAAACCAGGAGTAGGG + Intronic
1064583219 10:16814901-16814923 ATATTTATAAATGGGGAGAATGG - Intronic
1064810691 10:19194871-19194893 TACTGTATAAATCAGGATGAGGG - Intronic
1065502444 10:26395361-26395383 TTGCTTATAACTCTGGAGGATGG - Intergenic
1066219697 10:33323200-33323222 TTATTTAAAACACAGAAGGATGG - Intronic
1066627826 10:37427345-37427367 TTCTTTAGAAAATAGGAGGAGGG + Intergenic
1066792200 10:39078085-39078107 TTATTTTTAACTCAGCAGGTTGG + Intergenic
1067321214 10:45223000-45223022 ATATTTATAAATGGGGAGAATGG - Intergenic
1068990602 10:63146466-63146488 TTCTTTCTAAATCATGAAGATGG + Intronic
1071294719 10:84211403-84211425 TCCTTTATAAATGAGGAAGAGGG - Intronic
1071698615 10:87904427-87904449 TTTCTTATAAATCAGGAGAATGG + Intronic
1071737109 10:88313220-88313242 TTATTAATAAATTACGAGAAAGG + Intronic
1072567297 10:96627504-96627526 TTATTTATAAGACAGGCAGATGG + Intronic
1072889806 10:99313550-99313572 TTAGTTATAAAGCAGCAGCAGGG + Intergenic
1073235529 10:102012132-102012154 TTCTTTTTAAAGGAGGAGGAAGG + Intronic
1073795317 10:106981168-106981190 TTATTTATTTATCTGGAGGGAGG - Intronic
1074551045 10:114442711-114442733 TATTTTAGAAATCAGGAGGCTGG - Intronic
1074791253 10:116889791-116889813 TTATTTACAGATCTGGAAGATGG - Intronic
1074993299 10:118731704-118731726 TTATCTATAAAGCAGTAGCATGG + Intronic
1078073998 11:8140624-8140646 TTATTTAGGAATCAGGTTGATGG - Intronic
1080094879 11:28393944-28393966 TTTTTTAAAAATCAGGAGTATGG - Intergenic
1081454476 11:43207373-43207395 TTATTAAAAAGTCAGGAGGGTGG - Intergenic
1082661969 11:55922861-55922883 TAATTTCTAAATCAGGACGGGGG - Intergenic
1082730937 11:56796782-56796804 TTATTTATAAAGGACGAGGGTGG - Intergenic
1083002274 11:59303636-59303658 TTATTAATAAATGAGTAAGAAGG - Intergenic
1083020946 11:59506414-59506436 TTATCTAAAAATAAGGAGTATGG - Intergenic
1086076026 11:82853615-82853637 TTATTTTTAAATAAGGACGAGGG + Intronic
1086192350 11:84094589-84094611 TTATCTATGAACCAGGAAGAGGG - Intronic
1088128317 11:106456368-106456390 TAGTTTATAAATTAAGAGGAAGG + Intergenic
1088210221 11:107446259-107446281 TAAATTATAAAACAAGAGGAGGG - Intronic
1088464877 11:110124471-110124493 TTATTTATGAACCAGGATGTAGG - Intronic
1088516480 11:110640746-110640768 TAAATAATAAATCAGGGGGAGGG + Intronic
1088928003 11:114321659-114321681 TTATTTACAATTTAGGAGGCTGG - Intergenic
1089166158 11:116478124-116478146 TTATTTATAGTTAAGGAGGTTGG - Intergenic
1089597896 11:119593422-119593444 TTTTTTATAATTCTGGAGGTTGG + Intergenic
1090296017 11:125589417-125589439 GGACTTATAAATCAGGAGGGAGG + Intergenic
1090453867 11:126830324-126830346 ATACTTATGAAGCAGGAGGATGG - Intronic
1090530221 11:127583176-127583198 ATATCTACAAATTAGGAGGATGG - Intergenic
1090569596 11:128031792-128031814 TACTTTATAAAATAGGAGGACGG + Intergenic
1090763770 11:129859300-129859322 TTTTTTTTAAATCAGGAAGCTGG + Exonic
1090887821 11:130894756-130894778 ACATTTTTAAAACAGGAGGAGGG - Intronic
1092580811 12:9838947-9838969 TAATATATAAATTAGGGGGAGGG - Intronic
1093194649 12:16115668-16115690 TTATTTCTAAATAAAGAAGAGGG + Intergenic
1093501574 12:19818081-19818103 TTAGTTATAAAGAAGGAGAAAGG - Intergenic
1094218081 12:27966218-27966240 CTTTTTATAAATTAGAAGGATGG - Intronic
1094590557 12:31815566-31815588 TTATTTATAAAACAAGTGGTAGG - Intergenic
1096052781 12:48625859-48625881 TAATTTAACAATCAGGAGAAAGG - Intergenic
1097745830 12:63302292-63302314 TTAATTATCAGTGAGGAGGAAGG + Intergenic
1098606131 12:72392434-72392456 TTCACTATAAATCAGAAGGAGGG - Intronic
1098716726 12:73836290-73836312 TTATTTAAAAATAAGGTAGATGG - Intergenic
1098963436 12:76762798-76762820 CAATTTGTAAATCAGGAGGGAGG - Intergenic
1100380456 12:94056959-94056981 TTATTTACAAATCAGGCAGCAGG + Intergenic
1101025211 12:100596700-100596722 TTATTTATTAATCAGAATGAAGG - Intronic
1103426069 12:120835315-120835337 TATTTCATAAATCATGAGGATGG - Intronic
1104338121 12:127919857-127919879 TAATTTATAAATTAGGAAGTTGG - Intergenic
1104387055 12:128359930-128359952 TAATTTAGAATCCAGGAGGACGG + Intronic
1106241461 13:27916776-27916798 GTATTCATAAACCAGCAGGAGGG + Intergenic
1106868652 13:33995260-33995282 CTGTTTATATATCAGCAGGATGG + Intergenic
1107305267 13:39012454-39012476 TTATTTATAAGACAGCAGAAAGG - Intronic
1108462530 13:50680947-50680969 ATATTATTAAATCACGAGGATGG - Intronic
1109749165 13:66666906-66666928 TTAAATATAAAAGAGGAGGAGGG - Intronic
1110403308 13:75119629-75119651 TTATTTTTAATTCAGTAGTATGG - Intergenic
1110538145 13:76676608-76676630 TTAGTTATGTATCAGAAGGAAGG + Intergenic
1111350100 13:87016989-87017011 TAATTTATCAATCAGCAGGCTGG + Intergenic
1111638268 13:90933050-90933072 TTATTTATAAAATTGGAAGAAGG - Intergenic
1111736587 13:92148425-92148447 TTATTTAGAAAGCAGTAAGATGG - Intronic
1112872119 13:103985620-103985642 TTATGTATAATTCAGTAGAATGG + Intergenic
1113139990 13:107136771-107136793 GTATTTATAACTCTGGAGGAAGG + Intergenic
1113182532 13:107647051-107647073 TTATTTATAAATCAAAAGTTTGG + Intronic
1113698913 13:112368470-112368492 GTCTTTATAAATCAAGAGAAAGG + Intergenic
1115316540 14:32030629-32030651 TTATTTAAAAATCAGGGAGGTGG + Intergenic
1115872807 14:37824226-37824248 TTGTTTGTAAGTGAGGAGGAAGG - Intronic
1116193015 14:41684420-41684442 TTCTTTATAAGGCAGCAGGAAGG + Intronic
1116250054 14:42470277-42470299 TTTTTTAAAAATCTGGAGGCTGG + Intergenic
1116577293 14:46590275-46590297 TTTTTAATAAATCAGAAGGATGG - Intergenic
1116617967 14:47162735-47162757 AGATATATAAATCATGAGGAGGG - Intronic
1117074123 14:52084166-52084188 TAATTGATAAATCAGCAGCAGGG - Intergenic
1117303629 14:54452017-54452039 TTATTTATAAATCAGAAATTGGG - Intergenic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1118877973 14:69800641-69800663 TTTTTTATAATTCTGGAGGCTGG + Intergenic
1119378900 14:74216344-74216366 TTATTTTTAAAAAAGGAAGATGG - Intergenic
1119910247 14:78343413-78343435 GGATTTATACATCAGTAGGAAGG - Intronic
1120010009 14:79403163-79403185 TAATTTAGAAATCTGGAGGCTGG + Intronic
1120042075 14:79765242-79765264 TGATTTATACAGTAGGAGGAAGG + Intronic
1120315012 14:82880710-82880732 TTATTTCTGAACCAGGAAGATGG - Intergenic
1120582915 14:86276340-86276362 TTATTTATACAAAAGGAGGCAGG + Intergenic
1120708549 14:87770136-87770158 TTATTTAGAAATATAGAGGAAGG + Intergenic
1120910421 14:89661538-89661560 TTATTTACAAAACAGGTGGTGGG + Intergenic
1121411354 14:93750544-93750566 TTATTTATAAAACAGGTGGTGGG - Intronic
1121425808 14:93851082-93851104 GCATTTATAAAAGAGGAGGAGGG - Intergenic
1121869436 14:97393751-97393773 TTATTTATTTATGGGGAGGAGGG + Intergenic
1122043803 14:99009238-99009260 GTATTTGTAAATCAGGTAGAGGG - Intergenic
1122287826 14:100662705-100662727 TTATTTTTAAAAAAGGAGGGGGG - Intergenic
1122506821 14:102236865-102236887 TGATTTTTTAACCAGGAGGATGG - Intronic
1124148491 15:27154811-27154833 TTATTTTGATATCAGGATGATGG + Intronic
1125230950 15:37454353-37454375 TTATTTACAAAACAGGTGGGAGG - Intergenic
1125622888 15:41080297-41080319 TCATTTATAAATGAGGGTGATGG - Intronic
1125763008 15:42111168-42111190 TTATTTAGAAATCTGGAGATAGG + Intergenic
1126631689 15:50742818-50742840 TTATTTGTAAAACATGATGATGG - Intronic
1126845377 15:52755209-52755231 GTATTTATAATTTAGGAGGGAGG - Intergenic
1127441317 15:59011586-59011608 TCATTTATAAACCAAGAAGAGGG - Intronic
1127469675 15:59279388-59279410 TTAATGATAAAGCTGGAGGAAGG + Intronic
1127903945 15:63362168-63362190 TTATTTATAAAACAGGTGTTGGG + Intronic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128644626 15:69367299-69367321 TTAATTATAAAACAGGTGGAAGG - Intronic
1130037651 15:80376390-80376412 CTATATATAAATTAGGAGGGTGG - Exonic
1130228027 15:82074781-82074803 TTATTTATAGATCTGGAGACTGG + Intergenic
1130546180 15:84858656-84858678 TAATTTATGAATCCCGAGGAGGG - Intronic
1130696715 15:86138729-86138751 TTGATTATAAATCATGAGCAAGG - Intergenic
1131039889 15:89254531-89254553 TTATTTATTAATTATGAGTATGG - Intronic
1131347433 15:91663429-91663451 TAATTTCTAAATCAGGAACATGG + Intergenic
1133930895 16:10231353-10231375 TTATCTATAAACCAGGAAGGGGG - Intergenic
1133931120 16:10232850-10232872 TTATCTATAAACCAGGAAGCAGG - Intergenic
1135615743 16:23909382-23909404 TTATCTATAAGCCAAGAGGAGGG - Intronic
1139177748 16:64710118-64710140 TGCTTTAGAAAGCAGGAGGAAGG - Intergenic
1139926343 16:70489515-70489537 TTTTTTTTAAATCAGGATCAAGG - Intronic
1140379422 16:74473155-74473177 TTATTTAGAAATACAGAGGAGGG - Intronic
1140536212 16:75712160-75712182 TTATTTTTCAAGCAGAAGGAAGG + Intronic
1141017352 16:80463102-80463124 TTATTTACAGAGCAGGAGGCGGG + Intergenic
1141326375 16:83063390-83063412 TTATCTCAAAATCAAGAGGAAGG + Intronic
1143418109 17:6765098-6765120 ATTTTTAAAAATCAGGAGGTAGG - Intronic
1149149280 17:53540074-53540096 ATATTTACAAATCTGGAGGCTGG - Intergenic
1149231014 17:54534445-54534467 TGATTTGTAGATCAGGAGCATGG - Intergenic
1149942919 17:60890089-60890111 CTTTTTAGAAATCAGGAGGCAGG + Intronic
1150347055 17:64412300-64412322 ATAGTGATAAATCACGAGGAAGG + Intronic
1150891874 17:69161361-69161383 ATATTTAAAAATCATAAGGATGG + Intronic
1151139014 17:71974171-71974193 TTATTTATGAATGAGGTCGAGGG - Intergenic
1153219805 18:2851549-2851571 TCATTTAAATAACAGGAGGAGGG + Intronic
1153417153 18:4858954-4858976 TTATTTTTAAATGAGAAGGTGGG - Intergenic
1155996712 18:32338301-32338323 TTATTTCTAAAAGAGAAGGAAGG - Intronic
1156411774 18:36835958-36835980 TTATTTATAAAACAGGCAGAAGG - Intronic
1156445072 18:37230605-37230627 TTATTTATCAAATAGGTGGATGG + Intronic
1157353860 18:46916116-46916138 TTATTTTTGAAACAGCAGGAGGG + Intronic
1157581847 18:48778314-48778336 TCATTTATCAATCAGGAGGCGGG + Intronic
1157660050 18:49433575-49433597 TTAGTTATAAATAAGGAAGTAGG + Intronic
1157906767 18:51576219-51576241 TTATTTATAATTTAGGAAGCAGG + Intergenic
1163289035 19:16366563-16366585 TTATTTAGAAATCATGACTATGG + Intronic
1163606122 19:18276463-18276485 TTATTTAAAAATTAGTAGGGCGG + Intergenic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
925783152 2:7402336-7402358 TTACTTATTAATCCGGAAGAGGG - Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
927431575 2:23030759-23030781 TTTGGTATAAATCAGGTGGAAGG - Intergenic
929629014 2:43439379-43439401 TAATTTATAAATTATGAGTAGGG + Intronic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930015285 2:46965871-46965893 TTATTTGTAACTCTGGAGAAGGG + Intronic
930082641 2:47466012-47466034 TTATTTAGAAATAAGATGGAAGG + Intronic
930340618 2:50110178-50110200 TTATTTCTAAGTGAGGAGGGAGG - Intronic
930412304 2:51040113-51040135 TTATTTACAAATCGGAAGCAAGG - Intergenic
930899619 2:56488195-56488217 TAATTGATAAATCAGCAGCAGGG + Intergenic
930979902 2:57510998-57511020 TTCTTTATAAGGCAGCAGGAAGG - Intergenic
930998951 2:57758496-57758518 TCATCTAGAAAGCAGGAGGAGGG - Intergenic
931123480 2:59247237-59247259 TTATTTATAAATCTGCTGCAAGG + Intergenic
931998255 2:67859576-67859598 TTATTTACAAAACAGTTGGAGGG - Intergenic
933266577 2:80187309-80187331 TAATTTATAACGTAGGAGGAGGG + Intronic
934044519 2:88161497-88161519 TTATTTACAAATCAGGCAGTGGG + Intergenic
935181978 2:100699711-100699733 CTCTTTATAGATCAGGAGAATGG - Intergenic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
936487954 2:112942736-112942758 TTATTTATAAAACTGCAGGCAGG - Intergenic
937167490 2:119835059-119835081 TCCTTTATAAAGCAGGAAGAAGG - Intronic
937854806 2:126664540-126664562 TTCTTTTAAAATCAGAAGGAAGG + Intronic
938764725 2:134453148-134453170 TTATTTTTGAATCAACAGGAAGG - Exonic
938881070 2:135589507-135589529 TCAGTTATTAATCAGAAGGAGGG - Intronic
939119563 2:138100342-138100364 GTTTTTATAAATCAGGAAGTGGG - Intergenic
939420488 2:141962365-141962387 TTTTTAACAAGTCAGGAGGAAGG - Intronic
939890778 2:147733309-147733331 TCTTTTATAATTCAGCAGGAGGG + Intergenic
939995667 2:148916936-148916958 TTATTTATAAAACATGCTGATGG + Intronic
940018229 2:149129500-149129522 TCATTTATACTTCAGCAGGAAGG - Intronic
940483067 2:154260432-154260454 TTATTTTAAAATCAGTAGGATGG + Intronic
941059905 2:160835189-160835211 TTGTTTATATATCGGGAGAAAGG - Intergenic
941081553 2:161066769-161066791 TTACTTTAAAACCAGGAGGATGG + Intergenic
941460615 2:165767030-165767052 TTATTTATGAATGATGAAGAAGG - Intronic
941540507 2:166777323-166777345 TTATTTAGAGATCAGGGGGCTGG - Intergenic
941767963 2:169318653-169318675 TTCTTTATAAATGTGGAGCAGGG - Intronic
942528855 2:176886664-176886686 TTATTTCTAATTCAGTGGGATGG - Intergenic
942980600 2:182076499-182076521 ATATGTAAAAATCAGGAGAATGG + Intronic
943124935 2:183784357-183784379 CTATATATACTTCAGGAGGAAGG - Intergenic
943312684 2:186346154-186346176 TTATTTATAGAGCAGGAAGGGGG - Intergenic
943960420 2:194256000-194256022 TTATTTAAAAAAAAGGTGGAGGG + Intergenic
944184964 2:196937681-196937703 TTATCTATAGATAAGGAGGTTGG + Intergenic
944232715 2:197412213-197412235 TTCCTTATAATTCAGCAGGAGGG - Intronic
944341341 2:198604505-198604527 TTATTTATTAATCAGAATGATGG + Intergenic
946370085 2:219275906-219275928 TTAATAATAAATCTGGAAGATGG + Intronic
947328949 2:229008123-229008145 TTATGAATAAATAAGGGGGAAGG - Intronic
947430035 2:230019924-230019946 TTATTTATAAATCAGGAGGCTGG - Intergenic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
948431790 2:237923391-237923413 TTAATTAAAAATCAGGGGGCTGG - Intergenic
1170793852 20:19529689-19529711 TTATCTGTCAAACAGGAGGAAGG - Intronic
1173198425 20:40935101-40935123 TTATTTATATATTTGGGGGATGG - Intergenic
1173417738 20:42872639-42872661 TAATTTATGAATCAAGAAGAAGG - Intronic
1173969668 20:47142568-47142590 TTTTTTAAATATCAAGAGGAGGG + Intronic
1174774309 20:53329958-53329980 TTATTTATAAAACAGGCAGTGGG - Intronic
1174868368 20:54160619-54160641 TAATTTACAAAACAGGAAGAGGG + Intronic
1174997909 20:55591449-55591471 TACTTAAAAAATCAGGAGGACGG + Intergenic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1177513259 21:22117378-22117400 TTCTTTATAAGGCAGCAGGAAGG + Intergenic
1177842591 21:26251226-26251248 TTATTAATAAATCAGAAATAAGG + Intergenic
1178038788 21:28615630-28615652 TTATTTCAAAACCAGGAGGAGGG + Intergenic
1178040141 21:28631147-28631169 CCATTTATAAACCAGGAAGAGGG - Intergenic
1178501544 21:33129605-33129627 TTATTTAGAAATCAAAAGGGAGG - Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1179042667 21:37817673-37817695 TTATTTCTGAACCAGGATGAGGG - Intronic
1180857116 22:19055184-19055206 ATATATATAAACCATGAGGATGG + Intronic
1181882828 22:25994700-25994722 TAATTAATAAAACAGGAGGAGGG - Intronic
1184011961 22:41755709-41755731 TCTTTTATATATCAGGAGAAAGG + Intronic
1185157139 22:49200119-49200141 TACTGAATAAATCAGGAGGAAGG - Intergenic
949529668 3:4942372-4942394 TTCTTAATAAAATAGGAGGATGG + Intergenic
949844478 3:8356037-8356059 TTATTTATAAAAACAGAGGAGGG - Intergenic
950104983 3:10382651-10382673 TTAATTATACATCATGAGGCCGG - Intronic
951889973 3:27559407-27559429 TTTTTTATAGTTCTGGAGGATGG + Intergenic
952054921 3:29432767-29432789 TTAATTTGAAATCAGAAGGATGG + Intronic
952782883 3:37120946-37120968 ATTGTTATAAGTCAGGAGGAAGG - Intronic
953032998 3:39190257-39190279 TCATTTATAAATAAAGATGAGGG + Intronic
953395140 3:42563200-42563222 TTATTTATAAAACAGGCGGCTGG + Intronic
953691468 3:45123536-45123558 TTATTTATCAGTTAGGATGAGGG - Intronic
954533518 3:51340971-51340993 TTCTTTATTAATCTGGAGGCTGG + Intronic
955150514 3:56362282-56362304 TTATCTATAAAACAGGAAGTTGG - Intronic
955273109 3:57521370-57521392 TTAGTCAAAAATCAGGGGGATGG + Intronic
955314976 3:57930708-57930730 TAATTTTTAAGTCAGGAGCAAGG - Intergenic
955324212 3:57997287-57997309 TTTATTGTAAAGCAGGAGGAGGG - Intergenic
956553902 3:70495784-70495806 ATTTTTATAAATCAAAAGGAAGG - Intergenic
956713357 3:72057573-72057595 TTGTTCATAAATCAGGATAAAGG - Intergenic
957010571 3:75000918-75000940 TTACTTATAAATCACCAGGTTGG + Intergenic
957119295 3:76068973-76068995 TAATTGAGAAATCAGGAAGATGG - Intronic
957377498 3:79377553-79377575 TTATTTAGAAATAAAGTGGAGGG - Intronic
958586007 3:96088564-96088586 TCATTTAGAAATCAGGAGGTGGG - Intergenic
958948906 3:100396026-100396048 TTTTTTTTAAATCAGGAAAATGG + Intronic
959628361 3:108479700-108479722 TTATTTTGAAATCAGGAAGATGG + Intronic
960405256 3:117252061-117252083 TTTTCTATAAATTAAGAGGAAGG - Intergenic
960659844 3:120045490-120045512 TTTTTTTTAAATAAGGAAGAGGG - Intronic
960906547 3:122607426-122607448 TTATCTATAAATATGGATGATGG + Intronic
961206862 3:125090487-125090509 TTATTTATCAATTATTAGGAAGG + Intronic
961338565 3:126201191-126201213 TTATTTATTAATAAAAAGGAAGG + Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
963339400 3:144016330-144016352 TTATCTAGAAATCCAGAGGAGGG - Intronic
964055565 3:152452072-152452094 TTATCTTTAAATGAGGTGGAAGG - Intronic
964470756 3:157052658-157052680 TGATTTATAATTCTGGAGCATGG - Intergenic
964479449 3:157127375-157127397 TTAAGTAAAAATCAGGGGGAGGG + Intergenic
964585894 3:158301400-158301422 TTATCTATTTATCAGGAGTAAGG + Intronic
965707949 3:171528715-171528737 TTAGTTATAATTGGGGAGGAGGG - Intergenic
966323696 3:178730718-178730740 TTATTTAAAGATCAGAATGAAGG - Intronic
966354870 3:179069231-179069253 TTATTTGTTAAGAAGGAGGAGGG - Intronic
966471346 3:180292814-180292836 TTGTTTAGAAATCAGGAACAAGG + Intergenic
966588225 3:181651052-181651074 ATATTTATCACTCAGGAGAAAGG + Intergenic
967140334 3:186552584-186552606 TTATATCTAAGGCAGGAGGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967538777 3:190640491-190640513 TTGTTTACAACTCAGGAGAATGG + Intronic
970024095 4:11603178-11603200 TTATTTAAAAATCATGACAATGG + Intergenic
970276583 4:14407424-14407446 TTATTTATATCTCAAGAGCAGGG - Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
972134176 4:35871659-35871681 TTATTTAGAAATATGGAGTAGGG + Intergenic
972734940 4:41831320-41831342 TTATTTACAAAACAGGTGGTAGG + Intergenic
972911793 4:43825689-43825711 TTCTTTATAAGGCAGCAGGAAGG + Intergenic
973075687 4:45923065-45923087 TAATTTATAAGTCAAGATGAAGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
974120628 4:57633796-57633818 TTATTTACAAATCAGGTGGTAGG + Intergenic
974120662 4:57634102-57634124 TTATTTACAAAACAGGTGGTAGG - Intergenic
974194234 4:58550889-58550911 CTATTTATAAACCAGGAAGCAGG + Intergenic
974709483 4:65571994-65572016 TTATTTAAAAATAATTAGGAAGG - Intronic
974822808 4:67089535-67089557 TTATTTATAAACCATCAGCATGG - Intergenic
975027850 4:69575103-69575125 ATATTTATATATTAGGAGAAAGG + Intergenic
975171530 4:71237277-71237299 TTATTGATAAGTCAGGAGACAGG - Intronic
975653354 4:76616276-76616298 TTATTTATGATCCAGGAGGCAGG - Intronic
975990405 4:80254013-80254035 TTATTTATTAATAAGGCAGAGGG - Intergenic
976103270 4:81588433-81588455 TTTTTTAAAAATCAGGAGGCCGG - Intronic
976400290 4:84599085-84599107 TTTCTTATAAATCTGGAGGCTGG + Intronic
976588952 4:86830028-86830050 TTGTTTACAAAACAAGAGGAGGG - Intronic
977168564 4:93731124-93731146 TTTTTTACAAATCACGAGGTAGG - Intronic
977546960 4:98395068-98395090 TTATTCATAAATCATTTGGAAGG + Intronic
978068457 4:104435927-104435949 TTATTTATACATCATGATTAAGG - Intergenic
978073013 4:104494338-104494360 ATATTTAACATTCAGGAGGAGGG + Intronic
978278954 4:106986275-106986297 ATATTTATAAAACATGAAGAAGG - Intronic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
979932550 4:126649287-126649309 TTATTAATAACTCAGGGGAATGG - Intergenic
980776543 4:137444466-137444488 TTATTTATAAGACAGGTGGCAGG - Intergenic
981427624 4:144622021-144622043 TTATATATAAAACAGGGGAAGGG - Intergenic
981463401 4:145037644-145037666 TTATTTAAAAATCCAGATGAAGG + Intronic
982193705 4:152886183-152886205 TGATTAAAAAATCAGGAGCAAGG - Intronic
983114547 4:163796836-163796858 ACATTTATAATTCAGGATGAGGG - Intronic
983613546 4:169677328-169677350 TTATTTACAAAACAGGTGAAGGG - Intronic
983874096 4:172856149-172856171 TTATTTAAGAATCAGCAAGAAGG - Intronic
983944611 4:173571331-173571353 TTATTTATTGGTCAGGGGGAGGG + Intergenic
984088919 4:175346034-175346056 TTAATTTTAAAACAGTAGGAAGG + Intergenic
984944926 4:184963234-184963256 TTATTTACAAAGGAGGAGGCTGG - Intergenic
985313074 4:188625228-188625250 TTATCTATAAATTGGGTGGAGGG + Intergenic
985989758 5:3545964-3545986 TTACTTATTTGTCAGGAGGAAGG + Intergenic
986246223 5:6009369-6009391 TTTATTAGAAATCAGAAGGAAGG - Intergenic
986356400 5:6931604-6931626 TTCTTTATATATCTGGTGGAAGG + Intergenic
986553977 5:8991625-8991647 ATATTCTTAAATCAGGAGCAAGG - Intergenic
987861718 5:23497439-23497461 TTATTTTTAAATCAGCATGTTGG - Intergenic
988118656 5:26930214-26930236 TTTTTTAAAAATTAGGAGTAAGG + Intronic
988972780 5:36486547-36486569 TTCTTCATAAGTCAGCAGGAAGG - Intergenic
989013184 5:36897475-36897497 TTATTTGGAAAACTGGAGGAGGG - Intronic
989295970 5:39827028-39827050 TTATTTAAAGTACAGGAGGAAGG - Intergenic
989404151 5:41041661-41041683 GTATATATAAATGTGGAGGAAGG - Intronic
989517904 5:42364606-42364628 CCATCTGTAAATCAGGAGGAAGG + Intergenic
989959512 5:50394545-50394567 TTACTTATAAATTGGGAGGGTGG - Intergenic
990700196 5:58466780-58466802 TTATTTAATATTCAGGAGAAAGG + Intergenic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
991505816 5:67322945-67322967 ATATTTTGAAATGAGGAGGAAGG - Intergenic
991958858 5:72021748-72021770 TCATCTGTAAATGAGGAGGATGG - Intergenic
992594879 5:78336135-78336157 GTATTTATAAAACAAGAGGCTGG + Intergenic
993098841 5:83511613-83511635 GTAGTTATAAATGAGAAGGAAGG + Intronic
993317286 5:86426966-86426988 TTATTTAAAAATTAGGTGGGAGG - Intergenic
993595071 5:89844065-89844087 ATATCTATAAATCAGGAAGCTGG + Intergenic
993827749 5:92713293-92713315 TTGCTAATAAATTAGGAGGAGGG + Intergenic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994426726 5:99598947-99598969 TTATTTAAAAAACATGAAGAGGG - Intergenic
995345187 5:111106047-111106069 TTATTTATTAATCCTAAGGATGG - Exonic
995594336 5:113731652-113731674 ATATTTATAATCCAGGAGGTGGG - Intergenic
996286449 5:121798710-121798732 GTATTAATAAATGAGGAGGAAGG + Intergenic
996311826 5:122114961-122114983 TGCTTTATAAATTGGGAGGAAGG - Intergenic
996507563 5:124285454-124285476 GTCTTTAAAAAGCAGGAGGAGGG + Intergenic
997563270 5:134867259-134867281 TCATTTATAAATGATGATGATGG + Intergenic
997827012 5:137115468-137115490 TTATTTATAAAACTGAAGGTTGG - Intronic
998772281 5:145559611-145559633 TTTCTTAGAAATAAGGAGGAGGG - Intronic
1000156486 5:158557349-158557371 TTATTTATAAAACAGGTTGAAGG - Intergenic
1000490671 5:161909317-161909339 TTATCTGTAAATCAGAAGTAGGG + Intergenic
1001065996 5:168535598-168535620 TAATTTAAAAATCATGAGGCCGG - Intergenic
1004321128 6:14632587-14632609 TTTTTAATAAATGAGGAAGAAGG + Intergenic
1004630497 6:17416656-17416678 TTATTTAGACATAAGGGGGAAGG + Intronic
1004674434 6:17827459-17827481 TCATTTTTAAAACTGGAGGATGG + Intronic
1004792855 6:19047454-19047476 TGATTTAAAAATTAGGAGGAAGG - Intergenic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1007678653 6:43618949-43618971 TTATTTATAAATTGGGGGGGGGG + Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008850728 6:56017929-56017951 TTATTTACAAATATGGAGGAAGG + Intergenic
1009796841 6:68480101-68480123 TTTTTTACAATTCTGGAGGATGG - Intergenic
1010316135 6:74452542-74452564 TTATTTATCAATAAGGAGACAGG - Intergenic
1010320893 6:74508758-74508780 TTTTTTAAAAATGAAGAGGAGGG + Intergenic
1010363525 6:75022870-75022892 TTTTTTATAATTCTGGAGGCTGG - Intergenic
1010496377 6:76537765-76537787 TTAGTTGTAAAGCAGGAAGAGGG - Intergenic
1010660366 6:78563421-78563443 TTATTTAGAAGACAGGAGAAGGG + Intergenic
1012690054 6:102299194-102299216 TTCTTTAGAAATAAGGATGAGGG - Intergenic
1013265334 6:108491128-108491150 TTTTTTAAAAATCAGGACAAAGG + Intronic
1013905958 6:115220173-115220195 TCATTTAAAAATCTGGATGATGG - Intergenic
1014084187 6:117323767-117323789 TCATTTATAAATGACCAGGAAGG - Intronic
1014178448 6:118355829-118355851 TTATTTATATATAGGGGGGAGGG - Intergenic
1014348872 6:120313511-120313533 TTCTTTATAAGGCAGCAGGATGG + Intergenic
1014593786 6:123307122-123307144 TTATTGCCAAATCCGGAGGATGG - Intronic
1014816773 6:125944334-125944356 TTTTTTTTAAATCAGGAACAAGG - Intergenic
1014916429 6:127155081-127155103 TTAAATATAAAACAGGAGAATGG - Intronic
1015472768 6:133624655-133624677 TTATTTTTAAGTCAGGAAAAAGG - Intergenic
1015755953 6:136606633-136606655 TTATTTGTATATCAGAAGCAGGG - Intronic
1016134401 6:140521089-140521111 TACTTTATAAATAAGGATGAAGG - Intergenic
1016246562 6:141988516-141988538 TCATTTATAAATGAGGAGATTGG - Intergenic
1016493646 6:144634850-144634872 TTATTTATCAATGAAGAGAAAGG - Intronic
1016773488 6:147878236-147878258 CTATCTATGAATCAGGAAGAGGG - Intergenic
1016888302 6:148980215-148980237 TTTTTAAAAAATCAGGAGCATGG - Intronic
1017052488 6:150406862-150406884 GTTTTTAAAAATCAGGGGGAGGG - Intergenic
1017527200 6:155251957-155251979 TTCTTTATAAACCAGTATGACGG - Exonic
1017631757 6:156402784-156402806 TTATTTAAAAAACAGGCAGAGGG - Intergenic
1018026382 6:159809592-159809614 CTAGTTATAAATGAGAAGGAAGG - Intronic
1018258072 6:161941923-161941945 TTATTAATGAAGCAGGAGGTGGG + Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1020047455 7:5052449-5052471 TTATCAATTAATCAAGAGGAAGG - Intronic
1020554134 7:9649441-9649463 TTATTGATAAATATGTAGGAAGG + Intergenic
1021976950 7:26020343-26020365 TTTTTTATAATTCTGGAGGTTGG - Intergenic
1022269952 7:28796938-28796960 TCTTTTATAATTCAGCAGGAGGG - Intronic
1022311567 7:29200973-29200995 TTAATTATAAATGAGGAGAAAGG - Intronic
1022843658 7:34189604-34189626 TTATTTATAAATAAGGAACATGG - Intergenic
1023175275 7:37430041-37430063 CTATTTATAAATGTGGAGGGAGG - Intronic
1024463922 7:49689136-49689158 TTCTTTATGTTTCAGGAGGAGGG - Intergenic
1024850560 7:53710923-53710945 ATATTTATAAATCAGGATCTGGG + Intergenic
1025533280 7:61916954-61916976 TTATTTTTGATTCAGCAGGATGG + Intergenic
1027299927 7:76821463-76821485 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
1027547763 7:79550559-79550581 TTATTTCCAACTCAGGAGCATGG - Intergenic
1028113718 7:86973638-86973660 CTATTAATACATCAGGAAGATGG + Intronic
1029137937 7:98388015-98388037 TCATTTGTAAATAAGGAGGCAGG + Intronic
1029846585 7:103418182-103418204 TAATTTAGAAAGAAGGAGGAGGG - Intronic
1031512950 7:122671374-122671396 TAATTAATGAATCAGGAAGAGGG + Intronic
1031878690 7:127171340-127171362 TAATTTATAAAGCAGCAGCAGGG + Intronic
1032315832 7:130837465-130837487 TTATTTATTAACCTGGATGATGG - Intergenic
1033982231 7:147179643-147179665 TTATTTACAAATATGAAGGATGG + Intronic
1034784822 7:153916267-153916289 TTATTTAAAAATCAGAGGGCCGG - Intronic
1036521761 8:9498744-9498766 TTATTTGTAAATCTGGAGGAGGG - Intergenic
1037053610 8:14408005-14408027 ATATGTATAAATAAGGGGGAAGG + Intronic
1037275102 8:17169655-17169677 TGATTTATAAATGAAGAGCAAGG + Intronic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1040969706 8:53121693-53121715 TTAGTCAAAAATCAGGAGAATGG - Intergenic
1041820636 8:62028575-62028597 TTATTTATGAAAGAGGAGAAAGG + Intergenic
1042882270 8:73506809-73506831 TTGTTTATAAAACAGCAGCAGGG - Intronic
1043735455 8:83736270-83736292 TTAATCATAAATAAGTAGGAAGG - Intergenic
1044077813 8:87845330-87845352 CTGTCTATAAGTCAGGAGGATGG - Intergenic
1044797369 8:95917647-95917669 TTATTTACTAATTAGGTGGAGGG + Intergenic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1045192655 8:99898047-99898069 TTATTTATTAATCAGTGGGAAGG - Intergenic
1045510489 8:102808893-102808915 TTATTAGCAAAACAGGAGGAAGG - Intergenic
1045632045 8:104135792-104135814 TTAAGTATAAATGAAGAGGAAGG + Intronic
1045869994 8:106915458-106915480 ATAGTTATAAATCAGTGGGAAGG - Intergenic
1046187703 8:110744917-110744939 TGATTTGTAAATGAGGATGATGG - Intergenic
1046273767 8:111930108-111930130 TTATTTGAAAATCAGGCAGACGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047389386 8:124437810-124437832 TTTTCTATCAACCAGGAGGAAGG + Intergenic
1047427101 8:124756499-124756521 TGTTTTATAAATAAGGATGAAGG + Intergenic
1047524536 8:125621366-125621388 TTTTTTTTAAATCAGCAGAAGGG + Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1048615434 8:136069398-136069420 TTATTTACAAAACAGGTGGGCGG - Intergenic
1049151516 8:141038039-141038061 TTATGTTTAATTCAGGAGGAAGG + Intergenic
1049490230 8:142894598-142894620 TTATTAAGAAATCAGGGAGAGGG - Intronic
1051268136 9:15328412-15328434 TTATTTAGCAGCCAGGAGGAGGG - Intergenic
1051984506 9:23066944-23066966 TTATTTATAAATTATAAGGTTGG + Intergenic
1052025430 9:23568623-23568645 TTATTTATTATGAAGGAGGATGG + Intergenic
1052401892 9:28011182-28011204 TGATTTTTAAATCAGCAGTAAGG + Intronic
1052767758 9:32659152-32659174 TAATTTACAAATCAGGAAGCAGG + Intergenic
1054148156 9:61578815-61578837 TTATTTATAACTTAAGAGTAGGG - Intergenic
1055316615 9:75040184-75040206 TTCTTTTGAAATCAGGAAGATGG + Intergenic
1055599046 9:77896118-77896140 TTATTTACAAATCTGGGGGCAGG + Intronic
1055812689 9:80168078-80168100 TAATTGATAAATCAGTAGCAGGG - Intergenic
1056155909 9:83837473-83837495 TTATTTTTAGATCAAGAGGCTGG - Exonic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1057062452 9:92017855-92017877 TTCTTTATAATTCAGGAGTAGGG + Intergenic
1057098459 9:92334569-92334591 TTATTTTTAAATAATGAGTAAGG - Intronic
1057554357 9:96075796-96075818 TTATTTAAACAAGAGGAGGAGGG + Intergenic
1058343445 9:103926849-103926871 TTATTTATATATCAAGTGCATGG + Intergenic
1058343723 9:103931297-103931319 TCATTTATAAATAAGGAGTTTGG + Intergenic
1058488416 9:105466869-105466891 TAATTTATCAATCAGAAGAATGG - Intronic
1058633720 9:107016477-107016499 TCATTTAGAAACAAGGAGGAGGG + Intergenic
1058876610 9:109250187-109250209 TTTTTTGCAAATCAGGAGGTTGG - Intronic
1059100132 9:111463146-111463168 TCAGTCATAGATCAGGAGGAGGG + Intronic
1060455629 9:123792805-123792827 TTTTTTATATTTCTGGAGGAGGG - Intronic
1061857702 9:133451556-133451578 TTATTTAAAACTAAGGAGGCTGG - Intronic
1062639853 9:137513529-137513551 TTATTTATGACTCAGGAATAAGG + Intronic
1186005604 X:5067128-5067150 TTACTTAAAAATCAAGATGAGGG - Intergenic
1186531337 X:10298951-10298973 TTCTTTCTTAATCAGGAAGATGG - Intergenic
1186878314 X:13838974-13838996 TTATTTCCAAATTGGGAGGAGGG - Intronic
1186945486 X:14561415-14561437 TTATTTACAAAACAGGTGGTAGG - Intronic
1188906243 X:35795163-35795185 TTATTTTAAAATTGGGAGGAAGG - Intergenic
1189072243 X:37876181-37876203 TTATTTCTGAAATAGGAGGAGGG + Intronic
1193355119 X:80510953-80510975 TTATTTATAGATCATGAGTTTGG - Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193763013 X:85489976-85489998 TTATTTACAAAACAGGAAGAGGG + Intergenic
1194209057 X:91047236-91047258 TTATTTTAAAATCTGGAAGAAGG - Intergenic
1194453941 X:94079601-94079623 TTAGCTATAAATGAGGATGATGG + Intergenic
1194538520 X:95140810-95140832 TTATATAAAAATCTGGGGGAGGG - Intergenic
1194689941 X:96971994-96972016 TTAGTAAGAAATCAGCAGGAGGG + Intronic
1194773675 X:97936262-97936284 TTAGATATAAATCTGCAGGAAGG - Intergenic
1195120452 X:101745075-101745097 TTTTTTATAGGACAGGAGGAAGG + Intergenic
1195457884 X:105089997-105090019 TTATTTTTAAAGTAGGGGGATGG + Intronic
1195516814 X:105786334-105786356 TAATATATATATCAAGAGGAAGG + Intergenic
1197419456 X:126220389-126220411 TTTTAAATAAATCAGTAGGAAGG + Intergenic
1198944490 X:141995577-141995599 TTCTTTATATAGCAGGAAGAGGG - Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic