ID: 1178560919

View in Genome Browser
Species Human (GRCh38)
Location 21:33639033-33639055
Sequence TGAGATCTAAAGATAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178560919 Original CRISPR TGAGATCTAAAGATAGATAA AGG Intronic
900280906 1:1867989-1868011 GGAGTTCTAAAGAAAGAAAAGGG - Intronic
902422189 1:16289639-16289661 TGAGACCTAAAGAATGATAGTGG - Intronic
903626947 1:24737703-24737725 TAAGAAAAAAAGATAGATAAGGG - Intergenic
906498630 1:46323717-46323739 AGAGATATAAAGAAAGATATAGG + Intergenic
906861851 1:49369249-49369271 TGATTTCTAAAGATATCTAAAGG - Intronic
907692916 1:56688530-56688552 TGAGATCTAAAGGATGATTAGGG + Intronic
907713473 1:56906189-56906211 TCAGATCTAAAAATAGTTCATGG + Intronic
908066902 1:60415833-60415855 TGGGATATAAAGATAAGTAAGGG - Intergenic
908313745 1:62911993-62912015 TGAGTTCTAAAGACCAATAAAGG + Intergenic
909218507 1:72923575-72923597 AGAGATATGGAGATAGATAATGG - Intergenic
909851974 1:80478078-80478100 TAAGCTCTGAAGATGGATAAAGG - Intergenic
910037274 1:82803539-82803561 TAAGAACTAAAGATGAATAATGG + Intergenic
911464031 1:98228657-98228679 TTATATCTAAAGATATAGAAAGG + Intergenic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
913353605 1:117891961-117891983 TGAGATCTAAAGATAGACTTTGG + Intronic
913458799 1:119062034-119062056 TGAAATGTAAAAATAGATATTGG + Intronic
914427754 1:147594055-147594077 TGAGATCTTAAGGTAGATAGAGG + Intronic
917835192 1:178936220-178936242 TGAGAAGTAAAGATAATTAAAGG - Intergenic
918494425 1:185117611-185117633 TGTGATCTAAAGAAGGAAAATGG + Intergenic
922255187 1:223887474-223887496 TGTGAGCTAAAGATTCATAATGG + Intergenic
924148211 1:241099504-241099526 TGAGATTGAAACAAAGATAAAGG - Intronic
1062987989 10:1787785-1787807 TGACATTTAAAGATATAAAATGG - Intergenic
1065508484 10:26454138-26454160 TGGGATCTAAAAATAGAAACAGG + Intronic
1069404760 10:68087265-68087287 TGAGATTTAGAGATAATTAATGG - Intergenic
1070080526 10:73181870-73181892 TGAGAGCTAAAGAGAGATATAGG - Intronic
1070135193 10:73687850-73687872 TGAGACATAAAAGTAGATAAAGG + Intronic
1071946413 10:90650218-90650240 AGAGATCTAAAGATGGATAGTGG - Intergenic
1072504284 10:96048525-96048547 AAAGTTCTAAAGATAGATAGTGG - Intronic
1073549471 10:104384495-104384517 TGAGAACCAAAGAAAGAGAATGG + Intronic
1073706035 10:105985352-105985374 TGGGATTTATAGTTAGATAAAGG + Intergenic
1075189592 10:120294482-120294504 TGTGACCCAAAGATGGATAAAGG + Intergenic
1077666777 11:4117827-4117849 TGAGATCCAAAGTGAGGTAAAGG + Intronic
1079785501 11:24666243-24666265 TGAGAACTACAGATAGAGATGGG + Intronic
1081295493 11:41381829-41381851 AGAGAGCCAAAGAGAGATAAAGG - Intronic
1081647274 11:44798818-44798840 AGGGATATGAAGATAGATAAAGG + Intronic
1082909800 11:58358345-58358367 TGAGAACCACAGGTAGATAAAGG + Exonic
1086742563 11:90385849-90385871 GGAGATATATAGATAGATATAGG + Intergenic
1087574248 11:99970792-99970814 TGAGATTTTAATAGAGATAAAGG + Intronic
1087947595 11:104182906-104182928 TGAGATGTAAAGATGTATAATGG + Intergenic
1089287798 11:117418954-117418976 TGAGAGCTGTAGATAGGTAAAGG - Intergenic
1090224058 11:125058120-125058142 TGAGATCTAAGGAAAGACAGTGG - Intergenic
1090658432 11:128862884-128862906 TGAGATATTCAGAGAGATAAGGG - Intronic
1091121425 11:133060984-133061006 TGCGAGCTAAAGAAAGAAAAAGG + Intronic
1091438749 12:496183-496205 TGAGAGCTAGAGATGGACAAGGG - Intronic
1092306473 12:7306233-7306255 AGAAATCAAAAGATAGAAAATGG - Intronic
1092576446 12:9788518-9788540 CGTGATCTAAAGGTAGATATTGG - Intergenic
1092751147 12:11720136-11720158 TGATATCTGAAGATAGGAAAAGG + Intronic
1093617466 12:21244014-21244036 TTAGAGCTAAAGAGAGATATAGG + Intergenic
1094290839 12:28847888-28847910 TGAGTTCTAAAGACATAAAATGG + Intergenic
1094732196 12:33190813-33190835 TGTGATCTATATATAAATAATGG - Intergenic
1095342943 12:41113691-41113713 TGAGAACTAAAGAAGGAGAAGGG - Intergenic
1096042679 12:48531778-48531800 TGTGATCTAATGGTAGTTAACGG - Intergenic
1096726501 12:53567555-53567577 TGCCATCTAAGGAAAGATAATGG - Intronic
1096937576 12:55299836-55299858 TGAGACATGAAGATAGAGAAAGG - Intergenic
1097483294 12:60159862-60159884 TGATTTCTAAATATAGATAACGG - Intergenic
1097572363 12:61350325-61350347 AGAGATTTAAACATATATAAAGG - Intergenic
1097820610 12:64125255-64125277 TGAGATCAAAAGATATTCAAGGG - Intronic
1098497813 12:71156909-71156931 TGATATCTATCAATAGATAATGG - Intronic
1099417563 12:82410779-82410801 TGAGATCTAAAAACTAATAATGG + Intronic
1100427554 12:94501402-94501424 TGAGATCTGATGTTTGATAAGGG - Intergenic
1100800114 12:98222056-98222078 TGAGAAATAAGTATAGATAATGG + Intergenic
1100939428 12:99709612-99709634 TGAAATCTAAATATCCATAATGG + Intronic
1104201006 12:126588817-126588839 TCAGATCTAAAACAAGATAATGG + Intergenic
1105764326 13:23544334-23544356 TGATATATAAAGATAGTTAACGG + Intergenic
1107644423 13:42479329-42479351 TGAGACCTAAAGATTAAGAAGGG + Intergenic
1109017396 13:57035601-57035623 TGACACTTAAAGATATATAATGG + Intergenic
1109745606 13:66619740-66619762 TGAGCTCTACACATAGTTAATGG - Intronic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1110967536 13:81718939-81718961 TAACATAAAAAGATAGATAAGGG + Intergenic
1111258729 13:85706942-85706964 TAAGATATAAAGAGAGAAAAGGG + Intergenic
1111642855 13:90993116-90993138 TGAGATTTAAAGTGAGTTAAGGG + Intergenic
1111655594 13:91148717-91148739 TAAGACATAAAGATACATAAAGG + Intergenic
1112114556 13:96338012-96338034 TCACATCTAAAAATAGAAAAAGG - Intronic
1112195340 13:97220429-97220451 TGAGGTCTAAAGATTGAGTAAGG + Intergenic
1112876575 13:104048407-104048429 TGGGATCCATAGATAGATGATGG + Intergenic
1113081976 13:106529686-106529708 TAAGATGTAAAGGCAGATAAAGG - Intronic
1113198907 13:107842746-107842768 TGAGAGCTGATGAAAGATAAAGG - Intronic
1114198458 14:20500456-20500478 TGAGACATAAAGAGACATAAAGG - Intergenic
1115144907 14:30215210-30215232 TGAGATCCAAGAAAAGATAAAGG - Intergenic
1115803980 14:37030390-37030412 TGAGAGCTAGAGAGAGATCAGGG - Intronic
1115806637 14:37059519-37059541 TGATATCTTAAGTTATATAAAGG + Intronic
1115833312 14:37366778-37366800 TTAGAGCTAAAGAGAGATATAGG - Intronic
1116328792 14:43569494-43569516 TGAGTACTAGATATAGATAATGG - Intergenic
1116529766 14:45955760-45955782 TGAGATAGAAAGTTAGAGAAAGG - Intergenic
1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG + Intronic
1117045387 14:51808323-51808345 TGAGATTCAAACCTAGATAAGGG + Intergenic
1118493416 14:66284412-66284434 TGAGATGTATAGACAGAGAAAGG + Intergenic
1118507984 14:66436299-66436321 AGAGATCTAAGTATAGAAAACGG - Intergenic
1119907603 14:78319840-78319862 TGAGATCTAAACAAAAACAAAGG + Intronic
1120010150 14:79404642-79404664 TGAGATTTAAAAATGTATAAAGG + Intronic
1120603793 14:86546154-86546176 TGAAATCTGAAGAAAGAAAAGGG + Intergenic
1120726862 14:87953251-87953273 TTAGCTCAAAAGAAAGATAAAGG + Intronic
1121944457 14:98105602-98105624 TGATAGCTAAATATAAATAATGG + Intergenic
1122335970 14:100984174-100984196 TGAAGTCAAAAGATAAATAATGG + Intergenic
1122728211 14:103774672-103774694 AGACATCTAAGGATAGATTAAGG - Intronic
1123962689 15:25422451-25422473 TGAGAACTTAATATAGAAAAAGG + Intronic
1125614231 15:40995463-40995485 TAAGCTATAAAGGTAGATAAAGG + Intronic
1126458276 15:48888520-48888542 AGAGTTCTAAAGATGGATGATGG + Intronic
1126719891 15:51567394-51567416 TGTTATCTAAAGGTACATAAGGG - Intronic
1129498376 15:76010030-76010052 AGAGAGAGAAAGATAGATAAAGG - Intronic
1129624182 15:77179456-77179478 TGAGATGTAAAGAGAGATTTGGG + Exonic
1129642216 15:77392593-77392615 TGAGATATAAAGAGAGGTACAGG + Intronic
1130792374 15:87169164-87169186 TGAGATCTAAAGATAAGTCCTGG + Intergenic
1130916301 15:88307632-88307654 TGAGATGTAACTATAGATCAGGG + Intergenic
1134417206 16:14054515-14054537 TGAGAGCTAAAGAATGAAAAGGG - Intergenic
1137920102 16:52478466-52478488 TGAGATATAAAGGAAGAGAATGG - Intronic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1140314651 16:73883768-73883790 TGAGAACTAAAGATAAGCAAAGG + Intergenic
1140855365 16:78973178-78973200 TGAAATCCTAAGAAAGATAAAGG + Intronic
1141012934 16:80419966-80419988 GGAGATATGAAGATAAATAAAGG - Intergenic
1141308797 16:82893299-82893321 AGAAATCCAAAAATAGATAAAGG + Intronic
1144222707 17:13114539-13114561 TGAGATTTCCAGATAGAGAAAGG + Intergenic
1145924661 17:28637252-28637274 TGAGGAATAAAGATAGTTAAGGG - Intronic
1149308007 17:55367902-55367924 TGCGATCTAAGGCTAGAGAAAGG - Intergenic
1150508494 17:65723861-65723883 TGAGATTTAAAGTTAAACAAGGG + Intronic
1150598120 17:66625045-66625067 TGTGATCTATAGAAAGATGAAGG - Intronic
1150914708 17:69424785-69424807 TGTGATCAAAAGACATATAAAGG - Intronic
1153109789 18:1572005-1572027 ACAGATATAAAGATAGATTAAGG - Intergenic
1153478838 18:5526764-5526786 TGAAGTATAAAGATAGATATTGG - Intronic
1155119016 18:22799348-22799370 TGAGATAAAAGGATAAATAAAGG + Intronic
1155715631 18:28940115-28940137 TGAGATCCAGAAAGAGATAAAGG + Intergenic
1156057478 18:33025321-33025343 TGGGATCTAGAGGTAGGTAAAGG + Intronic
1157342624 18:46792714-46792736 TAAGCTCTCAAGAGAGATAAAGG - Intergenic
1157951068 18:52037843-52037865 TTAACTCTAAAGATAGAGAAAGG + Intergenic
1159239714 18:65726218-65726240 AGAAATCTAAAGGTAGAAAATGG - Intergenic
1162173967 19:8815907-8815929 AGAGATGTAAAGAGAGAAAAGGG + Intronic
1162856665 19:13473806-13473828 TGAGATGTAAAGAGAAATGAAGG - Intronic
1164494104 19:28742641-28742663 TGAGATTTAAAGAAAAATTAAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927581402 2:24252646-24252668 AAAGATCTAAAGGTAGAAAAAGG + Intronic
929014600 2:37481853-37481875 TGAGAGCTGAAGAGAGATATGGG + Intergenic
929016268 2:37499440-37499462 TGAGTTCTAAATATAGAAATGGG + Intergenic
929873215 2:45775148-45775170 TGAGATATAAACATGGACAATGG - Intronic
931019374 2:58025878-58025900 TGGGAGCAAAAGTTAGATAAAGG - Intronic
932853606 2:75212186-75212208 TGAGACCTAAAGAAACAGAAAGG - Intergenic
933571157 2:84014512-84014534 TGAAATAAAAAGACAGATAATGG + Intergenic
933739851 2:85524941-85524963 TGAGATCTAAAGTTACAAATTGG + Intergenic
935277659 2:101489431-101489453 AGAGTTCTAAAGATGGATGATGG - Intergenic
935847311 2:107180665-107180687 TACAATCTAAAGATAGTTAATGG - Intergenic
937212528 2:120284713-120284735 AGTGATCTAAAATTAGATAATGG - Intronic
938127551 2:128685466-128685488 TGAGATGTGAAGAGAGAGAAAGG + Intergenic
939294208 2:140237752-140237774 ATAGATATATAGATAGATAAAGG - Intronic
939368902 2:141272579-141272601 TGAGATCCAAAGATACAAATAGG + Intronic
939647984 2:144724693-144724715 TGAGATCTAATGCTTTATAAAGG - Intergenic
939687522 2:145217032-145217054 TGAGTTCTAAAGAGATTTAATGG + Intergenic
939732526 2:145802320-145802342 AGAGAGCTAAAGATAGAAAGTGG - Intergenic
939930196 2:148224686-148224708 TTAGAGCTAAAGATAGAGATAGG - Intronic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
941528959 2:166641155-166641177 TCAGATATAAAAAAAGATAAAGG + Intergenic
942363081 2:175193332-175193354 AGAAATATAAAGATAGGTAAAGG - Intergenic
942758143 2:179365890-179365912 TGAGATGTGAAGAAAGAGAAAGG - Intergenic
943216388 2:185042526-185042548 TTAGATCTAAAGAGAGAGATAGG + Intergenic
943943148 2:194024511-194024533 TGACATCTCAATATAGATAATGG + Intergenic
944139910 2:196444764-196444786 TGAGATCTGAAGTTAGCAAATGG + Intronic
944377261 2:199060658-199060680 TTAGATCTAAAGAAAGAGATAGG + Intergenic
944920888 2:204412096-204412118 TGAGATCTAATGGTATATAAGGG + Intergenic
945416650 2:209581536-209581558 TGAAATCTAAAAAGAGAGAATGG - Intronic
945441044 2:209880222-209880244 TTTGCTCTAAAGACAGATAATGG - Intronic
945607057 2:211947889-211947911 TGAGATTTGAATATAGTTAAAGG + Intronic
945676229 2:212858518-212858540 AGAGATCTAATGTTAGAGAAAGG - Intergenic
946203806 2:218089190-218089212 AGAGATCAAAAGATAGAAATGGG - Intronic
947441887 2:230130710-230130732 TGACTTCTGAAGATAGAGAATGG - Intergenic
947942429 2:234069911-234069933 TGATCCCTAAAGATAGAAAAGGG - Exonic
948280096 2:236740525-236740547 TGAAAACCAAAGATAGAAAAAGG + Intergenic
1170340128 20:15316308-15316330 TTAGATCTAAAGATAAATGTGGG + Intronic
1170762555 20:19263645-19263667 TGAGATCCACTGATAGGTAAGGG - Intronic
1170917626 20:20642613-20642635 AGAGAACTAAATATAAATAAGGG + Intronic
1171726672 20:28628251-28628273 TTAGATATAAAGATACATAGAGG + Intergenic
1171751596 20:29056360-29056382 TTAGATATAAAGATACATAGAGG - Intergenic
1171790740 20:29521516-29521538 TTAGATATAAAGATACATAAAGG + Intergenic
1171856968 20:30355322-30355344 TTAGATATAAAGATATATAGAGG - Intergenic
1172674850 20:36661539-36661561 GGATTTCTACAGATAGATAAAGG + Intronic
1172934792 20:38612245-38612267 TGAAATCTAAATATATATTAAGG - Intronic
1173283972 20:41654132-41654154 TGGAATCTAAGGATAGAGAATGG + Intergenic
1174102997 20:48141437-48141459 TGAGATGTAAGCATAGTTAAAGG + Intergenic
1174284945 20:49465813-49465835 TGAGATCTGAAGAAGGAGAAGGG + Intronic
1174861169 20:54092617-54092639 TTAGATCTAAAGATAGAAATAGG - Intergenic
1174994147 20:55546505-55546527 TCAGATCCAAAGATGGATAAAGG + Intergenic
1176526482 21:7922877-7922899 TGGAATCTAAAGATAGAGAATGG - Intergenic
1176947218 21:14997193-14997215 TGATATTTGAAGAAAGATAAAGG + Intronic
1177259763 21:18713973-18713995 TGAGGTCTAAAGAGTCATAAAGG - Intergenic
1177378433 21:20304918-20304940 AGAGACCCAAAGATAGACAAAGG + Intergenic
1177892890 21:26827555-26827577 TAAGATCTAAAGAATGATTAGGG + Intergenic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
1179069395 21:38057472-38057494 AGAGAGATAAAGATAGATATAGG - Intronic
1179271786 21:39857141-39857163 TCAGATCTAAAAATAGAGCAAGG + Intergenic
1179439050 21:41380509-41380531 TGAGATCCAAAGATCGAGTAGGG - Intronic
949978374 3:9481572-9481594 TCAGTTCTAAAGATAGATGATGG + Intergenic
950917937 3:16664619-16664641 TGCCATCTTAAGCTAGATAAAGG - Intronic
951929539 3:27949382-27949404 TTAGAGCTAAAGAGAGATACAGG - Intergenic
952045136 3:29309914-29309936 TGAGATTTAAAATTAGAAAAGGG + Intronic
952544362 3:34402986-34403008 TGACCTCTAAAGATTGATTATGG + Intergenic
954051353 3:47981251-47981273 TAATAGCTAAATATAGATAAAGG + Intronic
957244974 3:77704978-77705000 TGAGGTCTAAAGGAAGATGATGG - Intergenic
957641561 3:82860379-82860401 TGATATCTAAATATCGTTAAAGG - Intergenic
957882499 3:86238117-86238139 GGAGAACTAATGGTAGATAAAGG + Intergenic
957892130 3:86373675-86373697 TGAGAGTTAAATATATATAATGG + Intergenic
958698548 3:97557851-97557873 TGAGATATTAAGAAAGAAAAAGG - Intronic
959743699 3:109751551-109751573 TGAGTTCTGAAAATAGATAATGG - Intergenic
959841015 3:110974840-110974862 AAACATCTAAAGATATATAATGG - Intergenic
962862376 3:139416111-139416133 TTAGAGCTAAAGAGAGATATAGG - Intergenic
963091872 3:141489907-141489929 TGAGACCTCAATATATATAAAGG + Intronic
963963669 3:151340309-151340331 TGAGATTTAAATACAGATAAAGG - Intronic
964415621 3:156444674-156444696 TGGGATGTAAAGACAGGTAATGG - Intronic
964671862 3:159235205-159235227 TGAGATCAAAATATAGGTATAGG - Intronic
965269121 3:166589871-166589893 TGAGATCTTAGGACAGAAAAGGG + Intergenic
965961718 3:174436990-174437012 AGAGTTCTAAAGATAGATGCTGG + Intergenic
966282205 3:178245065-178245087 TTTGATCAAAAGACAGATAAAGG - Intergenic
967349615 3:188498281-188498303 TGAGTTCTGAAGATGGATACTGG - Intronic
967626809 3:191695979-191696001 TGAGATATACTGATAGATGATGG - Intergenic
969564480 4:7970064-7970086 TGAGATCAAAGGAAAGAAAAAGG + Intronic
969980928 4:11153533-11153555 TGAGAGATAAAGAGAGATAGAGG + Intergenic
970265267 4:14276065-14276087 TGAAATGTAAAGAGAAATAAAGG - Intergenic
971984437 4:33803286-33803308 TGAGAGCTGAAAATAAATAATGG + Intergenic
972124064 4:35741293-35741315 TGAGATCTGATGATTTATAAGGG + Intergenic
972745365 4:41926921-41926943 TGAGCTCTAAAGTTGGAAAAGGG + Intergenic
972997833 4:44904453-44904475 TAAGATTTAAAAATAGATATAGG - Intergenic
973548710 4:52009056-52009078 TGTGATCTTAAGATATATACTGG + Intronic
974243046 4:59276551-59276573 TTAGATCTAAAGAGAGAGAGAGG + Intergenic
974710132 4:65581096-65581118 GGAGAACAAACGATAGATAAAGG - Intronic
975095517 4:70452416-70452438 TGAAATCTAAAAACATATAATGG - Intronic
976457314 4:85263261-85263283 TGAGACCTAGAGACAGAAAAAGG - Intergenic
976470210 4:85419557-85419579 TCATATATAAAAATAGATAAGGG - Intergenic
976495189 4:85721089-85721111 AGAAATTTAAAGATAGAGAAAGG + Intronic
976615772 4:87074770-87074792 TGTGATCTCAGGATATATAATGG + Intronic
977946118 4:102916203-102916225 TTAGATCTAAAGACACACAAAGG + Intronic
978226881 4:106346553-106346575 TGAGATGTAAAGAAACAGAAAGG - Intronic
980505643 4:133716750-133716772 TCAGATATAAAGATATATGATGG - Intergenic
980564825 4:134526079-134526101 TGAGATCTAAAGTTGCATGATGG + Intergenic
980752744 4:137113280-137113302 TAAGATCTGAAAATAGACAAGGG - Intergenic
981422543 4:144567630-144567652 TGAGATCTGATGATTTATAAAGG + Intergenic
981651688 4:147066903-147066925 TGATTTCTAAAGATAAAAAAAGG - Intergenic
982450429 4:155545659-155545681 TGAGATCTAGATATAATTAAAGG - Intergenic
982457690 4:155629567-155629589 TGAGATCTCAAAATAGATTTAGG - Intergenic
983350851 4:166586448-166586470 TGAAATCTTAAGATAGACACTGG - Intergenic
983704247 4:170638610-170638632 TGAGATGTAAAGGTGGATGAAGG - Intergenic
984567949 4:181353774-181353796 TGTGATCTAAACATTGCTAAGGG + Intergenic
984984263 4:185312395-185312417 GAAGATCTCAAGAAAGATAATGG + Intronic
985045387 4:185935440-185935462 TGAGATATAAAGCAAGATAATGG + Intronic
985433981 4:189910681-189910703 TTAGATATAAAGATACATAGAGG - Intergenic
986464048 5:8003452-8003474 TCAAATCTAAAGACATATAAAGG - Intergenic
987214407 5:15718339-15718361 TAATATCTAAAGAAAGATGAAGG - Intronic
987497109 5:18660275-18660297 AGAGATATACAGATAGAAAATGG - Intergenic
988361166 5:30238586-30238608 TGAGGTCCAAAGATAGGTCAGGG - Intergenic
989434456 5:41394836-41394858 TCAGAGCTAAAGAAAGATATAGG + Intronic
991318574 5:65340952-65340974 TCAGATCTAAAGAGAGAGATAGG + Intronic
992079844 5:73225769-73225791 TGAGATAGAAAGAGAGATAGAGG + Intergenic
992381897 5:76245763-76245785 TCTGATCTAAAGATACTTAAAGG + Intronic
992819823 5:80485209-80485231 TGACATCTAAACATGAATAAAGG - Intergenic
993213219 5:84982190-84982212 TGTGTTCTAAAGAAAAATAATGG + Intergenic
993786303 5:92142148-92142170 CCACATCTAAAGATAAATAATGG - Intergenic
994139961 5:96331256-96331278 TGACATTTAAGGAAAGATAAAGG - Intergenic
994608248 5:101999046-101999068 TGACTTCTAAAGATAGATTCTGG + Intergenic
994674798 5:102807022-102807044 TGAGATCTAAATATACAGTACGG + Intronic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
998210268 5:140191786-140191808 TGTGATTTAAAAATAAATAATGG + Intronic
998533127 5:142903439-142903461 TTAGATCTAAAATGAGATAAAGG - Intronic
999014608 5:148087685-148087707 AGAGATTTAAAGATTTATAATGG - Intronic
999346851 5:150830454-150830476 TCAGATCTAAAGATACACATAGG + Intergenic
1000362716 5:160462819-160462841 TTAGTTTGAAAGATAGATAAAGG - Intergenic
1001490683 5:172152741-172152763 TGACATCTAAACACAGATCAAGG + Intronic
1001829759 5:174775888-174775910 AAATATCTAAAGATAGATATAGG - Intergenic
1004697526 6:18047587-18047609 TGATATATAAAGAGAGACAAGGG - Intergenic
1004787142 6:18981706-18981728 TGAGATCTGAGTATAGATAGAGG + Intergenic
1006645813 6:35513187-35513209 TGAGAAATAAAGATAAATACAGG - Intergenic
1006754269 6:36401300-36401322 TGAAATCTAAGTATAGATCAAGG - Intronic
1008165910 6:48137935-48137957 GGAACTCTAAAGAAAGATAAAGG + Intergenic
1009722507 6:67490754-67490776 TTAAATATAAAGATAGATACAGG + Intergenic
1010697791 6:78998884-78998906 TGAGATCTAGTGGTAAATAAGGG + Intronic
1011713200 6:90076197-90076219 TGAGATTTAAAGACACGTAAAGG + Intronic
1011747391 6:90419495-90419517 TGAAACCTAAAGTTAAATAAGGG - Intergenic
1012541272 6:100364773-100364795 TGGGATTTAAAGATGGAAAAAGG + Intergenic
1013138627 6:107308157-107308179 TGAAATATATAGATAGATTAAGG - Intronic
1013458468 6:110354132-110354154 TGAGAGCCAATGATAGATGATGG - Intronic
1013987188 6:116208943-116208965 TGTGATTAAAAGATACATAAAGG + Intronic
1014052375 6:116969723-116969745 TGAGATTTACAGAAAGAGAAAGG - Intergenic
1015596170 6:134869504-134869526 TGAAAAATAAAGATATATAAGGG + Intergenic
1015608105 6:134982620-134982642 TGAGAACTAAGTATAGTTAACGG - Intronic
1015728554 6:136324592-136324614 TTATTTCTAAAGATAGATAATGG - Intergenic
1016567813 6:145476292-145476314 TTAGAGCTAAAGAGAGATATAGG + Intergenic
1017687276 6:156926181-156926203 TGAGATCAAAAGATTGAACAAGG + Intronic
1017979642 6:159389132-159389154 TGAGATCAAAAGATATAAATAGG - Intergenic
1018655453 6:166029899-166029921 TGATTTATAAATATAGATAATGG + Intergenic
1021132050 7:16923115-16923137 TGAGATCTCAAAAAAGATAGTGG - Intergenic
1021412732 7:20346510-20346532 TGGGATCTCAAGGTAGATAGTGG + Intronic
1021718071 7:23479211-23479233 AAAGAGCTAAAGATAGATACTGG + Intergenic
1023525721 7:41100738-41100760 TGAAATCTAAATATAGAAAATGG - Intergenic
1024018652 7:45344423-45344445 TGAGATCCAAGTATAGAAAAAGG + Intergenic
1024102529 7:46047477-46047499 TGACTCCTAAAGATAAATAATGG - Intergenic
1025799996 7:64777129-64777151 TGAGAGCTAAAGAGAGAGATAGG - Intergenic
1028899273 7:96077860-96077882 TGATATCTAGAGAAAGAGAAGGG - Intronic
1028975222 7:96905261-96905283 TGAGATCTTGAGAGAGAAAATGG + Intergenic
1029591127 7:101507718-101507740 TGAGATCTAAGGTAAGAAAATGG - Intronic
1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG + Intergenic
1031200974 7:118684886-118684908 TGAGATCTACAAATATAGAAAGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036944474 8:13081717-13081739 TAAGATCTAAAGAAAAATGAAGG - Intergenic
1039236060 8:35503823-35503845 TAACATCTAAAGAAAGAGAATGG + Intronic
1039313647 8:36347790-36347812 TGAGATCTAATGGTTTATAAGGG - Intergenic
1039816749 8:41101056-41101078 TGAGAGCTAAAGAAAGATGCAGG + Intergenic
1040815768 8:51507238-51507260 TTAGATTTAAAGATAAAGAAAGG + Intronic
1041360053 8:57043306-57043328 TAACTTCTAAAAATAGATAAAGG + Intergenic
1041559450 8:59198462-59198484 TGAGAATTAAAGATAAACAAAGG + Intergenic
1042726574 8:71885261-71885283 TGAGAGCTAAAGAGAGAGACAGG - Intronic
1043206715 8:77453210-77453232 AGAGATATAAAAAGAGATAAAGG - Intergenic
1044021161 8:87107416-87107438 TGAGACCTAAAGAAAGAGCATGG - Intronic
1044948399 8:97413020-97413042 TGAGAAGAAAAGATAGAAAAGGG - Intergenic
1045388161 8:101690504-101690526 AGAGGTCAAAAGATAGATACTGG - Intronic
1047990392 8:130280225-130280247 TGAGAAGTAAAGGTAGAAAAGGG - Intronic
1048096971 8:131307357-131307379 TGAGAGCAAAAGAAAAATAAAGG - Intergenic
1048578564 8:135711953-135711975 TGAGATCCAGAGAAAGAGAAAGG + Intergenic
1052269287 9:26609747-26609769 TGAGAGCTCAAGAAGGATAAAGG + Intergenic
1052335334 9:27313597-27313619 TGATTTCTAAATATAGTTAATGG + Intergenic
1052793297 9:32898319-32898341 TGAGAACAAAAGAGAGAAAAGGG - Intergenic
1053723067 9:40968852-40968874 TTAGATATAAAGATACATAGAGG - Intergenic
1053751841 9:41265262-41265284 TGAAATCTCAAGATTGAAAATGG + Intergenic
1054782318 9:69176393-69176415 TGAGATCTAAAGATACAAGTAGG + Intronic
1056149080 9:83766147-83766169 TGAGATCTAATGGTCTATAAGGG + Intronic
1058227050 9:102377954-102377976 TGAGATGTGAAGATAGAAGATGG - Intergenic
1203452076 Un_GL000219v1:127130-127152 TTAGATATAAAGATACATAGAGG + Intergenic
1186539571 X:10386741-10386763 TGAAATTTAAAGATAGATAAGGG + Intergenic
1187364185 X:18652841-18652863 TGTGATCATGAGATAGATAAAGG + Intronic
1188132833 X:26458718-26458740 TTATTTCTAAAGATAGAAAATGG - Intergenic
1188220849 X:27539811-27539833 TGAGACCTCAATCTAGATAAAGG - Intergenic
1188996345 X:36890557-36890579 TTAGAGCTAAAGAGAGAGAAAGG + Intergenic
1189853079 X:45196174-45196196 TTAGATGTATAGATAGATAAGGG + Intronic
1190743901 X:53309421-53309443 AGAGTTCTAAAGAAAGAGAAGGG - Intronic
1192366589 X:70478802-70478824 TCAGCTCTAAAGATTTATAAAGG + Intronic
1193448538 X:81637373-81637395 AGAGGTAGAAAGATAGATAAGGG + Intergenic
1193940409 X:87674964-87674986 TGACATCTACAGAAAGGTAAAGG - Intergenic
1194239758 X:91430415-91430437 AGAGTTCTGGAGATAGATAATGG + Intergenic
1196041194 X:111206121-111206143 AGAGAAATGAAGATAGATAAGGG - Intronic
1197139489 X:123100744-123100766 TCACATATAAAGATATATAAAGG + Intergenic
1198130378 X:133688101-133688123 TGAGACCAAGAGAAAGATAAAGG - Intronic
1199153821 X:144523117-144523139 TGAAATCAAAAAATATATAATGG - Intergenic
1199467520 X:148155937-148155959 TGAGAAAATAAGATAGATAAAGG + Intergenic
1199614339 X:149644819-149644841 TGAAATGTAAAGTTAGATAAAGG - Intergenic
1199908893 X:152263061-152263083 TGAGTTCTCAAGAGATATAAGGG - Intronic
1201181817 Y:11355613-11355635 TTAGATCTAAACATACACAAAGG + Intergenic
1201241502 Y:11961210-11961232 AGAGATCAATAGATAGATGAAGG - Intergenic
1201367878 Y:13228319-13228341 TGAGATCCACAGATCCATAATGG + Intergenic