ID: 1178565155

View in Genome Browser
Species Human (GRCh38)
Location 21:33677233-33677255
Sequence CTGCAGTTCTTGGGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178565155_1178565163 17 Left 1178565155 21:33677233-33677255 CCTACTTCTCCCAAGAACTGCAG 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1178565163 21:33677273-33677295 TCTAGTAGGCAGATCTTCTTGGG 0: 1
1: 0
2: 1
3: 8
4: 121
1178565155_1178565161 3 Left 1178565155 21:33677233-33677255 CCTACTTCTCCCAAGAACTGCAG 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1178565161 21:33677259-33677281 TAGATGGGCAGCTGTCTAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1178565155_1178565162 16 Left 1178565155 21:33677233-33677255 CCTACTTCTCCCAAGAACTGCAG 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1178565162 21:33677272-33677294 GTCTAGTAGGCAGATCTTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178565155 Original CRISPR CTGCAGTTCTTGGGAGAAGT AGG (reversed) Intronic
901475345 1:9485581-9485603 CTGGGGTTCATGGGAAAAGTTGG - Intergenic
901558208 1:10048362-10048384 TTGCAGTTCTTGGGGGAGGTTGG + Intronic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
904696193 1:32332885-32332907 CTGCAGTTCTAGGCAGAGCTAGG + Intronic
907280931 1:53346636-53346658 CTGCACTTCTTGGCAAACGTTGG - Intergenic
911769263 1:101718623-101718645 CTGTAGTTCCTTGGAGAGGTAGG + Intergenic
912398246 1:109365941-109365963 CTGCTGTTCTTGGCCCAAGTGGG - Intronic
912472677 1:109916368-109916390 CTGATGTTTTTGGGAGAAGGAGG - Intronic
913538550 1:119797282-119797304 CTGCTGTTCAAGGCAGAAGTTGG - Intronic
914356439 1:146888582-146888604 CTGTAGCTCATGGGAGAGGTCGG + Intergenic
914947491 1:152079875-152079897 CTGCAGCTCTTGGATCAAGTAGG - Intergenic
915143501 1:153780892-153780914 CTGTAGTTCCTAGGAGAAGCAGG - Intergenic
915343375 1:155188181-155188203 CTGCAGCTCTTGGTAGTAGTCGG + Exonic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
915599815 1:156915009-156915031 CTGGAGGCCTTGGGAGCAGTGGG - Exonic
917327033 1:173843738-173843760 GAGCTGTTCTTGGGAGAAGCTGG + Intronic
917483741 1:175435544-175435566 CTGGAATTCAAGGGAGAAGTTGG + Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
917868214 1:179218104-179218126 CTACAGTTCCTGGAAGAATTGGG - Intronic
917968416 1:180192752-180192774 CTGGAGTTCCAGGGAGAGGTGGG + Intronic
920074049 1:203324224-203324246 CTCCACTTCCTGGGAGATGTGGG + Intergenic
920469952 1:206219821-206219843 CTGCAGTTTTAAGGAGAATTAGG - Intronic
920791681 1:209098810-209098832 CTGCAGTTCATAGGATATGTTGG + Intergenic
921773154 1:219067367-219067389 CTGCTGCTCTTTGGAGAGGTGGG + Intergenic
922739008 1:228005346-228005368 CCGCAGTGCCTGGGAGAAGCGGG + Intergenic
924459386 1:244244859-244244881 CACCTGTTCTTGGGAGAAGAGGG + Intergenic
1063596834 10:7442893-7442915 CTGCAGTTCTCTGCAGAGGTAGG + Intergenic
1064052472 10:12069962-12069984 CTGCATTGCTTGGGAGAAGTGGG + Intronic
1064250109 10:13700418-13700440 CGTGAGTTCTTGGGAGAAGGTGG - Intronic
1066026335 10:31363117-31363139 CTGCAGCTCTTGGATCAAGTAGG - Intronic
1066632209 10:37468537-37468559 CTGCAGTTCTATGGTGAGGTTGG - Intergenic
1069024262 10:63522186-63522208 CTGCAAATCTTGGGAAAACTAGG - Intronic
1069789462 10:71010442-71010464 CAGCATCTCTTGGAAGAAGTGGG + Intergenic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1070851957 10:79571457-79571479 CTGCAATCCTTTGGAGAAGAAGG - Intergenic
1071466171 10:85941917-85941939 ATGCAATTCCAGGGAGAAGTAGG - Intronic
1071693241 10:87844527-87844549 CTGGGGTTCCTGGGAGAACTTGG - Intergenic
1073160145 10:101386372-101386394 CTGCAGTTCTGGGGAGGCCTGGG + Intronic
1074286468 10:112102602-112102624 TTGAAGTTCCTGGGAAAAGTGGG + Intergenic
1074688745 10:115983300-115983322 TTGCAGTTCTTTGGAGTAGGGGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1076133301 10:128028467-128028489 CTGCATTTCTTAGGAAAAATGGG + Intronic
1076615894 10:131754459-131754481 CTGCAGTGCAGGGGAGAGGTGGG + Intergenic
1076615969 10:131754753-131754775 CTGCAGTGCAGGGGAGAGGTGGG + Intergenic
1076616004 10:131754879-131754901 CTGCAGTGCAGGGGAGAGGTGGG + Intergenic
1078425933 11:11251419-11251441 TAGCAGTTCTGGGGAGAAGCAGG + Intergenic
1086245485 11:84746946-84746968 ATGGGGTTCTTGGGAAAAGTTGG - Intronic
1086855698 11:91862482-91862504 GTGCAGGGCTGGGGAGAAGTTGG + Intergenic
1088474353 11:110219832-110219854 CTGAAGTTCAGGGGAGAATTTGG + Intronic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1090363907 11:126190708-126190730 CTGCAGTTTGGGGGAGAACTAGG - Intergenic
1090396299 11:126421372-126421394 CTGCCGTCCTTGGTAGAGGTGGG + Intronic
1090528059 11:127559191-127559213 CTGGAGCTCCAGGGAGAAGTTGG + Intergenic
1090657964 11:128860201-128860223 ATGCAGTGCTTGGGAGAATCCGG + Intronic
1092736379 12:11586969-11586991 CTTCAGCTCTTAGGAGAGGTTGG - Intergenic
1094073761 12:26450079-26450101 CAGCAGTTCTTGGCATATGTTGG - Intronic
1095918676 12:47506980-47507002 CTGGAGTTGTGGGGAGAGGTTGG + Intergenic
1096332273 12:50724231-50724253 ATGCAGTTCGTGGGCAAAGTAGG + Intronic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1099247063 12:80204866-80204888 CTGGAGCACTTGGCAGAAGTTGG + Intergenic
1099792070 12:87348919-87348941 TTCCACTTCTTGGGAGAGGTAGG - Intergenic
1102644274 12:114393762-114393784 CTGCATTGCTTGGGAGAAGGTGG - Intronic
1103988037 12:124780381-124780403 CTGCCTTGCTTGGGAGAAGGGGG - Intronic
1104721628 12:131047741-131047763 CAGCATTTCTTGGAAGACGTGGG + Intronic
1105725404 13:23158780-23158802 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1107270157 13:38606861-38606883 CTGCAGGTCTTGTGAGCACTGGG + Intergenic
1107459715 13:40590074-40590096 CTGCTGTTATTGGGAGGAGTTGG - Intronic
1107619296 13:42209097-42209119 CTGCACTTCTTGGGCTAAGGAGG + Intronic
1107788441 13:43977498-43977520 GTGCAGATTTTGGGAGAAGCTGG - Intergenic
1108003736 13:45927366-45927388 CTGCAGACCTTGGGGGAAGTTGG + Intergenic
1108497148 13:51036194-51036216 CAGAGGTTCTTGGGAGAAGGGGG - Intergenic
1108615966 13:52132463-52132485 CTGCAGATCTTGTCAGAAGATGG - Intergenic
1110339220 13:74369559-74369581 TTGAAGTTCCAGGGAGAAGTTGG - Intergenic
1110626695 13:77661694-77661716 CTGCAGCTCTTGGATCAAGTAGG - Intergenic
1110628231 13:77675989-77676011 CTCCAGGTCCAGGGAGAAGTAGG + Intergenic
1111458280 13:88511608-88511630 CTGCACTTCTGGGTAGAATTTGG - Intergenic
1115184047 14:30664486-30664508 CTGCAATCCTTTGGAGAAGAAGG - Intronic
1115630893 14:35244120-35244142 CTGCTTTTCTTGGCAGAAATGGG - Intronic
1119219502 14:72894385-72894407 CTGCAGTTATTTAGAAAAGTAGG - Intergenic
1119949189 14:78727188-78727210 CAGCAGTCATTGAGAGAAGTGGG + Intronic
1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG + Intronic
1121711672 14:96043265-96043287 CTGCACTTCTTGGATGATGTGGG - Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1125974884 15:43942519-43942541 ATGCATTTTTTGGGAGAAGAGGG - Intronic
1127266249 15:57364695-57364717 CTGCAGTCCTAGGTAAAAGTTGG - Intergenic
1128891030 15:71331845-71331867 CTGAAGTTCAAGGGACAAGTAGG - Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1130577974 15:85109223-85109245 CTCCAATTCTTGGGAGAGGAGGG + Intronic
1130886132 15:88094129-88094151 CTGCAGCCTTTGGAAGAAGTGGG + Intronic
1131645611 15:94338940-94338962 CTGCAGTTCCTAGGAGAGGGTGG + Intronic
1133313568 16:4867629-4867651 AAGAAGTTATTGGGAGAAGTGGG + Intronic
1134487841 16:14672741-14672763 CTGCCGGTCCTGGAAGAAGTGGG + Exonic
1134510607 16:14843951-14843973 TTCCAGTTTTTCGGAGAAGTTGG + Intronic
1134698246 16:16242437-16242459 TTCCAGTTTTTCGGAGAAGTTGG + Intronic
1134973591 16:18552240-18552262 TTCCAGTTTTTCGGAGAAGTTGG - Intronic
1136037916 16:27554534-27554556 GTGCAGATCCTGGGAGAAGGAGG - Intronic
1138829343 16:60358773-60358795 CTGCAGCTCTTGGATCAAGTAGG - Exonic
1139573377 16:67826915-67826937 CTGCTGTTCCTGGGAGTGGTGGG - Intronic
1139977577 16:70826881-70826903 CTGTAGCTCATGGGAGAGGTCGG - Intronic
1140722019 16:77780633-77780655 CTGCAGTGCTTGGAAGAGGCAGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1143066894 17:4256562-4256584 ATGCAGATCTTGGGGGGAGTCGG + Intronic
1145201552 17:20949829-20949851 CTGCTGTTCTCTGGAGTAGTCGG + Intergenic
1147671235 17:42178059-42178081 CTGGAGGACTTGGGAGATGTTGG + Intronic
1147907350 17:43831935-43831957 CTGCAGATTCTGGGAGAAGGGGG + Exonic
1147948072 17:44091733-44091755 CTGCAGCCCTAGGGAGATGTTGG + Exonic
1150171650 17:63002280-63002302 AGGCAGTTCTCTGGAGAAGTGGG + Intergenic
1150347034 17:64412159-64412181 CTGCAGTTCTTGGGCCACGTAGG + Intronic
1150920716 17:69479249-69479271 CTGTACTGCTTGGAAGAAGTAGG - Intronic
1150950839 17:69801210-69801232 CTGCTGTTCTTTGGAGCAGGAGG - Intergenic
1151745983 17:76012018-76012040 CTGCAGGGCCTGGGAGAGGTGGG + Exonic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1152802069 17:82335091-82335113 CTGCAGTTCCTGGGGGCAGGGGG + Intergenic
1152891095 17:82882113-82882135 CTGCACTTCCTCGGAGAAGCTGG - Intronic
1153002286 18:466377-466399 CTGGAGCTGTTGGGAGAAGGCGG - Intronic
1153982286 18:10320720-10320742 ATGCAGTTATGGGGAGAAATGGG - Intergenic
1154955935 18:21254655-21254677 CTGCAATTCTTGGGTTAATTTGG + Intronic
1158886560 18:61833452-61833474 CAGGAGTTCTTGGTAGAAGCTGG - Intronic
1159954212 18:74507951-74507973 CTTCAGTTTTTGTGAAAAGTTGG + Intronic
1159963920 18:74577914-74577936 CTGCAGATCTTGGGCAAAGAGGG + Intronic
1160235839 18:77086201-77086223 CTCCAGCTCTTAGGACAAGTTGG - Intronic
1160468848 18:79108074-79108096 CTGCTGTTGGTGGGAGGAGTTGG + Intronic
1160771107 19:831650-831672 CTGCAGTTCTGGGGTGGCGTGGG + Intronic
1164445860 19:28317080-28317102 AGGCAGTGCTTGGGGGAAGTTGG - Intergenic
1165028035 19:32976079-32976101 CTGCAGCTCCTGCGTGAAGTAGG + Intronic
1165071740 19:33259777-33259799 CTGGAGTTCTTGGGAGGTGGAGG - Intergenic
1166123866 19:40702205-40702227 CTGCAGGTTGTGGGAGAAGGTGG - Intronic
1167213785 19:48150478-48150500 CTGCAGCTGCTGGGAGGAGTGGG - Intronic
927852674 2:26510226-26510248 CTGCAGGTCGTGGGTGGAGTTGG - Intronic
928423343 2:31157225-31157247 CAGTTGGTCTTGGGAGAAGTCGG - Intergenic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
930178518 2:48326148-48326170 TTGGAGATCTTGGGAGAAGAAGG - Intronic
930892430 2:56406450-56406472 GTGCAGTTCTTGGCAGAGGGAGG + Intergenic
932063251 2:68528532-68528554 CTGCAGCTCTTGGATCAAGTAGG - Intronic
932436453 2:71704969-71704991 CTGCAGTGATTGGGAGCAGATGG + Intergenic
932910268 2:75799231-75799253 TTGCAGTTCTGGAGAGATGTGGG + Intergenic
932969187 2:76517696-76517718 TTGCAGTTGGTGGCAGAAGTCGG + Intergenic
933010764 2:77059864-77059886 CTGCTGCTCTTGAGAGAAGTTGG - Intronic
934060801 2:88291039-88291061 CTGGACTTCTTGGGTGGAGTGGG + Intergenic
935761022 2:106320825-106320847 CTGGACTTCTTGGGTCAAGTGGG - Intergenic
937862183 2:126719914-126719936 GTGCAGTCCTTGAGTGAAGTAGG + Intergenic
938342094 2:130542394-130542416 CTGCCCTTCTTGGGAGCTGTGGG - Intronic
938347738 2:130578317-130578339 CTGCCCTTCTTGGGAGCTGTGGG + Intronic
938719427 2:134052875-134052897 GTGAAGTTCTAGGGAGAAGGTGG - Intergenic
939524834 2:143279949-143279971 CTGGAGATCTTGGGAGAGCTTGG + Intronic
939908738 2:147952718-147952740 CTGAACTTCTTGAGAGCAGTCGG - Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941978952 2:171434213-171434235 TTGTAGTTCCTGGGAGAAGCCGG + Intronic
942057895 2:172202028-172202050 CTGCTGTTCTTGGGATCAGATGG - Intergenic
943004047 2:182367640-182367662 CTGCATTTGATGGGACAAGTAGG + Intronic
943282118 2:185947960-185947982 CTGCAGATCTTAGGACATGTCGG + Intergenic
943642286 2:190372897-190372919 CTGGAGTGTTTGGGAGATGTTGG - Intergenic
943699353 2:190973015-190973037 CTGCAGTCCTGTGGAGCAGTTGG - Intronic
944302657 2:198142046-198142068 GTGCGGTTCATGGGAAAAGTGGG + Intronic
945945873 2:215995112-215995134 GTGCAGTTCTTGGCAGCAGCAGG + Intronic
947069301 2:226268943-226268965 CCGCAGTTCTCTTGAGAAGTAGG + Intergenic
947746814 2:232512196-232512218 CAGCAGTTCTGGGGAGGAGGGGG - Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG + Intergenic
1170161388 20:13315668-13315690 CTGCTGTTGTTGGATGAAGTAGG - Intergenic
1170323110 20:15123207-15123229 CTGCAGCTCTTGGAAGCTGTAGG + Intronic
1170690902 20:18614302-18614324 GTGCAGTTCTCGGGAAAACTTGG + Intronic
1172105199 20:32513038-32513060 CTGAAGTCCTTGGAAGAAGGAGG - Intronic
1173440387 20:43070235-43070257 TTGCATTTCTTTGGAGAAGGAGG - Intronic
1174025944 20:47575021-47575043 CAGCAGCTATTGGGGGAAGTGGG - Intronic
1177596972 21:23257012-23257034 ATGCAGTTCTTTGGAGAATTTGG + Intergenic
1178125063 21:29507263-29507285 GTGGAGGTCTTGGGAGATGTGGG + Intronic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1178628788 21:34241332-34241354 GTGCTGTTGTTGGGAGAAGCTGG + Intergenic
1178966138 21:37120121-37120143 CTGCTGTTACTGTGAGAAGTGGG + Intronic
1179104260 21:38384097-38384119 GGGCAGTTCTCTGGAGAAGTGGG - Intronic
1179221150 21:39408655-39408677 CTTCAGCTCTTGGGAGTAGGTGG - Intronic
1181380947 22:22503435-22503457 CAGCAGTTGTTGGGAGATGGGGG - Intronic
1181848194 22:25730126-25730148 CTGCAGCTCTTGAGAGGGGTTGG - Intergenic
1184085021 22:42256159-42256181 CTGGAGTGCTGGGGAGAACTAGG - Intronic
953664518 3:44916436-44916458 CTGCAGTTCAGAGGAGAAGAAGG - Intronic
954755077 3:52834801-52834823 CTGCAGCCCTTGGGAGATGGGGG - Intronic
955156996 3:56426675-56426697 CTGCTGTTCTGAGGAGAAGGTGG + Intronic
956167200 3:66405779-66405801 CTGCAGGCCTTGGGAGGAGATGG - Intronic
958177589 3:90016235-90016257 CTGCAGAGCTGGGGAGAAGCGGG + Intergenic
959532669 3:107451449-107451471 CATCACTTCTTGTGAGAAGTGGG + Intergenic
960064050 3:113351889-113351911 CAGGAGTCCTTGGTAGAAGTTGG - Intronic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
964470285 3:157045716-157045738 CTGCCATTCTTAGGAGAAGGCGG + Intronic
965064797 3:163832722-163832744 CGAAAGTTCTTGGGAGAAGTTGG + Intergenic
965261604 3:166493039-166493061 CTGAAGTTATTGGAAGAAGGAGG - Intergenic
967303584 3:188039703-188039725 CTGCAGTTCATGGGTGAAATGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967562990 3:190939332-190939354 CTGCAGTTCTTGCCTGAAGAAGG + Intergenic
968607791 4:1543693-1543715 CAGCTCTTCTTGGGGGAAGTGGG - Intergenic
968910918 4:3476585-3476607 CAGCAGTTCTCAGGGGAAGTGGG - Intronic
971477362 4:27084861-27084883 CTGCAGTGCTTAGGAGAATGCGG + Intergenic
971605298 4:28651142-28651164 CTGCAGTTTGTTGGAGATGTGGG + Intergenic
972669712 4:41203704-41203726 CTGGAGTACTGGGGAGAATTGGG - Intronic
977141134 4:93373762-93373784 GTGCCATTCTTGGGAGAACTGGG + Intronic
985348895 4:189036644-189036666 CTGCACTCCTTGGGAGATGGAGG - Intergenic
989070201 5:37502352-37502374 TTCCAATTCTTGGGAGAGGTGGG + Intronic
999788075 5:154910474-154910496 TTGCAGTTCTTGGTAGAAATGGG + Intronic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1005632104 6:27717805-27717827 CTGCAGATCTTGGGATTTGTTGG + Intergenic
1005658603 6:27968899-27968921 CTGCAGTTCTTTATAAAAGTTGG - Intergenic
1005707470 6:28469663-28469685 CTGGAGTTCCGGGGAGACGTGGG - Intergenic
1007274127 6:40661139-40661161 CTGCAGGTTGTGGGAGAAGGGGG - Intergenic
1009398551 6:63229404-63229426 CTGCAGCTCTTGGATCAAGTAGG - Intergenic
1010344691 6:74798317-74798339 CTGGAGTTCTGGGGAGGACTAGG + Intergenic
1010569286 6:77458510-77458532 CAGGGGTACTTGGGAGAAGTTGG - Intergenic
1010655813 6:78509334-78509356 CTGAAGTTCTCGGGAGAACTAGG + Intergenic
1011686865 6:89830296-89830318 ATGGAGTTCTTTGGAGAAATGGG + Intronic
1012038802 6:94177506-94177528 CTGCAGTGCTGGGGAGGGGTTGG - Intergenic
1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG + Intronic
1014138790 6:117917734-117917756 GTGGAATTCTGGGGAGAAGTCGG + Intronic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1017705077 6:157114816-157114838 CTGCACCTCTAGAGAGAAGTAGG - Intronic
1018500666 6:164407821-164407843 CTGCATTCCTTTGGAGAAGAAGG - Intergenic
1018694355 6:166380019-166380041 CTGCCATTCTTGGCAGCAGTGGG - Intronic
1019696822 7:2450877-2450899 CTGCAGGGCTTGGGGGAGGTGGG + Intergenic
1019817418 7:3211351-3211373 CCACAGTTCTTGGGAGATCTCGG + Intergenic
1019906991 7:4072401-4072423 CTGCAGCTCTTTGGAGGAGAAGG + Intronic
1020377565 7:7505188-7505210 CTGAAGTTGTAGGGAGCAGTTGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1023479283 7:40615608-40615630 CTGCTGTTCAGTGGAGAAGTTGG + Intronic
1025222154 7:57121121-57121143 CTGAAGGTCTTGGGTGAAATGGG + Exonic
1025632937 7:63292792-63292814 CTGAAGGTCTTGGGTGAAATGGG + Intergenic
1025649760 7:63455391-63455413 CTGAAGGTCTTGGGTGAAATGGG - Intergenic
1026505689 7:70980670-70980692 CTGCAGTTATTGGCAGGTGTGGG - Intergenic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1027780421 7:82513666-82513688 TTGCAAGTCTTGGGAGAAGGGGG - Intergenic
1028017707 7:85736160-85736182 CTGCAGTTCTACGCAGTAGTTGG + Intergenic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1031125088 7:117764315-117764337 CTGCAGTGCTGGGGAGAGGAGGG - Intronic
1034386155 7:150742820-150742842 CTCCAGTTCTTTGGAGCAGCTGG - Exonic
1035093694 7:156334754-156334776 CTGCAGTGCTGGGTTGAAGTGGG - Intergenic
1035242979 7:157544224-157544246 CGGGAGGCCTTGGGAGAAGTGGG + Intronic
1035366181 7:158350368-158350390 CTGCACTTCCTGGGTGAAGCAGG - Intronic
1037389582 8:18379821-18379843 CTGCAGACCAAGGGAGAAGTGGG + Intergenic
1038372930 8:27011439-27011461 CTGCAGTTCTTGGATCAAGTAGG - Intergenic
1038459622 8:27704990-27705012 CTGCCCTCCTGGGGAGAAGTTGG - Intergenic
1038602898 8:28965580-28965602 GAGCAGTTCTTGGGAGAGGCTGG + Intronic
1039276555 8:35938859-35938881 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1043374382 8:79632058-79632080 CAGCAGTTAATGGGAGAAATAGG - Intronic
1045260782 8:100571552-100571574 CTGCAGGTGCTGGGAGAAGATGG - Intergenic
1048521924 8:135164130-135164152 TTTCAGTTCTTGGGAGAATCAGG + Intergenic
1051533262 9:18129022-18129044 CTGCAATTGTTTGGAAAAGTGGG - Intergenic
1052413411 9:28148896-28148918 CTGCAGCTCTTGGGTCAAGTAGG + Intronic
1053066541 9:35073039-35073061 CTCCAGGTTTTGGGAGAAGATGG - Exonic
1055591708 9:77822644-77822666 CTGAAATTCTTGGGAGCATTTGG - Intronic
1056020196 9:82432207-82432229 CTGCAGCTCTTGGATCAAGTAGG - Intergenic
1056275372 9:84989567-84989589 CAGCAGTTCTTGAAAAAAGTGGG - Intronic
1056576342 9:87858352-87858374 CTGCAGCTCTTGGATCAAGTAGG - Intergenic
1057071701 9:92105111-92105133 CTGCAGCTCTTGGATCAAGTAGG + Intronic
1060392796 9:123292195-123292217 CTGGAGCTCCTGGGAGATGTGGG - Intergenic
1186574777 X:10753035-10753057 CTGCAGTTTTAAGGGGAAGTTGG + Intronic
1187124830 X:16445303-16445325 CTGCAGGACTTGGCAGAAGCAGG - Intergenic
1187185286 X:16978631-16978653 CAGAAGTTCTTGGTAGAAGAGGG + Intronic
1188458564 X:30395757-30395779 CAGCAGTTGTTTGGAGAAGAAGG + Intergenic
1190291399 X:48995173-48995195 TTCCAGTTCCTGGGAGGAGTTGG + Intronic
1191990270 X:67027261-67027283 CTGCATTCCTTTGGAGAAGGAGG - Intergenic
1192354160 X:70384429-70384451 CTAGAGTTCAAGGGAGAAGTTGG + Intronic
1194128256 X:90046659-90046681 CTGCAGTGCTTGGTAGAAAGGGG + Intergenic
1195844991 X:109217142-109217164 CTGCAGGTATAGGGAGAGGTTGG + Intergenic
1198219402 X:134585912-134585934 CAGCATTGCTGGGGAGAAGTTGG + Intronic
1199030469 X:142992979-142993001 CTGAAGTTCTCCTGAGAAGTGGG + Intergenic
1200034898 X:153320826-153320848 CTGCAGTGCTTGGGAGGGGAGGG - Intergenic