ID: 1178573626

View in Genome Browser
Species Human (GRCh38)
Location 21:33764390-33764412
Sequence CAGAATAAGGAAGAGCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178573621_1178573626 12 Left 1178573621 21:33764355-33764377 CCTAGGACTGGCTAATTGTGAGA 0: 1
1: 0
2: 0
3: 18
4: 150
Right 1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 256
1178573619_1178573626 28 Left 1178573619 21:33764339-33764361 CCTTCTAACTGGTTTACCTAGGA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178573626 Original CRISPR CAGAATAAGGAAGAGCGGGC AGG Intronic
901135873 1:6994963-6994985 CAGAATCAAGAAGCTCGGGCCGG - Intronic
901627804 1:10633613-10633635 CAGGAGGAGGAAGAGCGGCCAGG - Intergenic
901651585 1:10746206-10746228 CAGGATTTGGAAGAGCGGGGAGG + Intronic
901944986 1:12694581-12694603 AAGAATAATGAACAGCTGGCTGG + Intergenic
902664517 1:17928077-17928099 CAGGAGAAGGAAGAGAGGGGCGG - Intergenic
903510222 1:23869072-23869094 CTGAAAGAGGGAGAGCGGGCAGG + Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904373868 1:30067178-30067200 GAGAAGGAGGAAGAGAGGGCAGG - Intergenic
904420278 1:30386689-30386711 CAGAACAAGGAAGATGGGGGAGG + Intergenic
905078654 1:35297144-35297166 AAGAAAAAGTAAGAGCAGGCTGG - Intronic
909427942 1:75549418-75549440 AAGAAGAAGGAAGAGTGGGGCGG - Intronic
911165198 1:94718855-94718877 GAGAATACGGTAGAGCGGGATGG + Intergenic
912070730 1:105806452-105806474 GAGGACAAGGAAGAGCGGGAAGG + Intergenic
912601984 1:110945382-110945404 CGGAAGAAGGAAGAGGGGGAGGG - Intergenic
912674032 1:111660598-111660620 CAGAATCAGGAAGAACTGGAAGG - Intronic
913179919 1:116311453-116311475 CAGAAGAGGGAAGAGCAGACTGG - Intergenic
913490360 1:119374152-119374174 CAGCATGGGGAAGAGAGGGCAGG - Intronic
914706798 1:150176904-150176926 CATGAAAAGGAAGAGCTGGCCGG + Intergenic
915505408 1:156352724-156352746 AAGAATGAGCAAGAGCGGCCGGG - Intronic
916983736 1:170167646-170167668 CCTAATAAGGAAGAGTGGGCTGG + Exonic
917030202 1:170682137-170682159 CAGAATGAGGAAGAAAGGGATGG + Intronic
920417253 1:205807132-205807154 CAGATTCAGGAAGAGCGGGATGG - Intronic
921295046 1:213693533-213693555 CAGAAAAAGGAAGAGGGATCGGG + Intergenic
922563750 1:226587751-226587773 GAGAATGAGGAAGAGTGGACAGG - Intronic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922685277 1:227633983-227634005 GAGGAGAAGGAAGAGCGGGGAGG + Intronic
922923764 1:229330544-229330566 CAGAAAAAGAAAGTGCAGGCCGG + Intronic
922980677 1:229823878-229823900 CAGAAGAAAGCAGAGCAGGCAGG - Intergenic
923870571 1:237988978-237989000 AACAAAAAGGAAGAGCGGGGAGG - Intergenic
1063294144 10:4785111-4785133 CAAAATAAGGAAGGGCTGGCTGG + Intergenic
1064253876 10:13727742-13727764 CAGAGTAAGGAAGAGCGGGAGGG - Intronic
1065478158 10:26163564-26163586 AAGAATAGGGAAGAGTAGGCTGG + Intronic
1066076931 10:31888194-31888216 CAGAATAAGGGAGAGGTGCCAGG - Intronic
1070509782 10:77150281-77150303 AAGAAGAAGGAAGACAGGGCTGG - Intronic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071603236 10:86969087-86969109 CAGAATACGGAGGAGAGAGCTGG - Intronic
1073158663 10:101370407-101370429 CAGGATAAGGAAGAAGGGGCGGG - Intronic
1076727622 10:132420855-132420877 CAGAAAAGGGAAGTGCTGGCTGG - Intergenic
1079571791 11:21952547-21952569 AAGAAGAAGGAAGAGTGGGAAGG + Intergenic
1081725076 11:45322330-45322352 GAGAAGAAAGAAGAGAGGGCAGG + Intergenic
1084607960 11:70183591-70183613 CAGAATAAAGAGGAACGAGCTGG + Intronic
1085387584 11:76165777-76165799 CAGAATGAGGACTGGCGGGCAGG + Intergenic
1085506438 11:77063488-77063510 CAGAACCAGGAAGAGAGGGGTGG + Intergenic
1086188099 11:84044011-84044033 GAAAATAAGGAAGAGAGGGAGGG - Intronic
1086877802 11:92118393-92118415 CAGAATGGGGAAGAGTGGGAGGG + Intergenic
1087265650 11:96058162-96058184 TAGAATAATGTAGAGAGGGCTGG + Intronic
1088797255 11:113274262-113274284 CAGGAGAAGCAAGAGTGGGCTGG - Intronic
1089452651 11:118608418-118608440 CGGGATAGGGAAGTGCGGGCGGG + Intronic
1089877403 11:121738220-121738242 AAGAAAAAGGAAGACTGGGCCGG - Intergenic
1090520637 11:127475344-127475366 CAGAAAAAGGAAGAGGGGAGAGG - Intergenic
1091274342 11:134340364-134340386 CAGAATGAGGAAGAACTGGATGG - Intronic
1093454796 12:19354448-19354470 AAGAATAACTAAGATCGGGCTGG - Intronic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1097195324 12:57239685-57239707 CAGAATAGGGAAGAGAGAGATGG - Intronic
1097214397 12:57398783-57398805 CTGAGAAAGGAAGAGAGGGCTGG - Intronic
1098330910 12:69352575-69352597 TAGAATAAGTAAGTGTGGGCCGG + Intronic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100471370 12:94896328-94896350 CAGAATAGGGAAGGGGTGGCAGG + Intergenic
1100718295 12:97328689-97328711 GAGAATTAGGAGGTGCGGGCAGG + Intergenic
1103202486 12:119099427-119099449 TATTATAAGGAAGAGCGGCCGGG - Intronic
1103897126 12:124280073-124280095 CAGCAAAAGGCAGAGCAGGCAGG - Intronic
1104640824 12:130465783-130465805 CAGACTGAGGAAGCGCCGGCCGG - Intronic
1107758489 13:43651246-43651268 AAGAAAAAGGAAGAGGGGGAGGG + Intronic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1113088023 13:106587762-106587784 CAGAACCAGGAAGAGCAGGATGG - Intergenic
1113481521 13:110625444-110625466 CAGAATAAGACAGAGACGGCGGG + Intronic
1114422762 14:22598420-22598442 CTGGAAAAGGAAGAGCGGGAAGG - Intronic
1114429127 14:22645488-22645510 CTAAATAAGGTAGAGGGGGCTGG + Intergenic
1116442702 14:44972005-44972027 GAGAAGGAGGAAGAGAGGGCAGG + Intronic
1117062531 14:51977872-51977894 CAGATTAAGGGAGAGCGTGAAGG - Intronic
1117400917 14:55358018-55358040 CAGAATAGGGAAGGGTGGGTGGG - Intronic
1117869935 14:60189756-60189778 CAGAAAAAGGAAGAAGGGACTGG - Intergenic
1118727479 14:68639365-68639387 GAGAATATGGAAGACCTGGCAGG + Intronic
1119120247 14:72068789-72068811 GAGAGAAAGGAAGAGTGGGCCGG - Intronic
1121732836 14:96198188-96198210 TAGAATTAGGAAGAGTGGCCAGG + Intergenic
1123020735 14:105396797-105396819 AAGAAACAGGAAGAGCAGGCAGG - Exonic
1124350590 15:28952989-28953011 CAGGAAAAGGAAGAACAGGCGGG + Intronic
1124592652 15:31067070-31067092 GAGAATAAGGAAGACCTGGTTGG - Exonic
1125979340 15:43985622-43985644 AAGGATAAGGATGAGCTGGCTGG + Intronic
1126228222 15:46296078-46296100 AATAATAAGGAAGAGGGGGAAGG + Intergenic
1127467452 15:59258051-59258073 CAGAAAATGGAAGTGAGGGCTGG + Intronic
1128034613 15:64513789-64513811 CAGATTAAGGAACAGCCAGCTGG + Intronic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1131512584 15:93057416-93057438 CAGAAGGAGGGAGAGGGGGCAGG - Intronic
1132944584 16:2525973-2525995 CAGAAAAAGGAACACTGGGCTGG - Intronic
1133062514 16:3183841-3183863 TAGAATAAGGAAGAATGCGCCGG - Intergenic
1133063136 16:3188390-3188412 TAGAATAAGGAAGAATGCGCCGG + Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1135296544 16:21283984-21284006 CAGAAGGAGGAAGGGCTGGCCGG - Intronic
1135804967 16:25534397-25534419 GAGAATAAGGATGAACTGGCCGG + Intergenic
1136092300 16:27929225-27929247 CAGAAGAAGGGAGAATGGGCTGG - Intronic
1138753532 16:59454149-59454171 TAGAATAAGGAAGAGCAAGGAGG - Intergenic
1139355068 16:66362783-66362805 CAGAAGGAGGAAGAGCGGGAAGG - Intergenic
1140192467 16:72829635-72829657 CAGAAAAAGGATGAGTGGGAGGG - Intronic
1140768560 16:78182559-78182581 CAAAAGAAGGAAGGGAGGGCAGG - Intronic
1142141504 16:88474693-88474715 CAGGATGGAGAAGAGCGGGCTGG - Intronic
1142708088 17:1709090-1709112 CAGCAAAATGAAGAGAGGGCCGG + Intronic
1143843741 17:9756140-9756162 TAGAATAAGGAAGTGGTGGCCGG - Intergenic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1144745719 17:17612986-17613008 CAGTAAAAGGTAGAGCTGGCCGG + Intergenic
1146302652 17:31702062-31702084 CAAAATAACGAAGAGTGGGCTGG - Intergenic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1147196582 17:38770560-38770582 GGGAAGAAGGAAGAGGGGGCAGG + Intronic
1147700221 17:42388884-42388906 CGGGAAAAGGGAGAGCGGGCAGG - Intergenic
1147917532 17:43897710-43897732 AAGAATGAGGAAGAGGGGGAGGG - Intronic
1148335057 17:46835505-46835527 AAGAATAAGGGAGACTGGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1153497545 18:5715418-5715440 CAGAAAAGGGAAGAGTTGGCAGG + Intergenic
1153835766 18:8962663-8962685 CAAAAAAAGGCAGAGTGGGCTGG - Intergenic
1157199752 18:45650021-45650043 CAGAAAAAGGAAGAGATGGAGGG - Intronic
1157502237 18:48199647-48199669 GAGAATGAGGAGGAGCGGGAGGG - Intronic
1158338961 18:56445009-56445031 AAGAATAAGGAAGAGAGAGGTGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1161204408 19:3033592-3033614 CAGAAGAAGGAAGATCTGGAGGG - Intronic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1163113038 19:15172995-15173017 AAGAAGAAGGAAGAGGGGGAGGG - Intronic
1164155785 19:22596164-22596186 CAGAAAAAGGAAGCGCAGCCAGG - Intergenic
1164554322 19:29239241-29239263 CAGAATAAAGTAGAGCTGGGAGG - Intergenic
1165289118 19:34868877-34868899 CAGAACAAGGAAGAGCCTCCTGG + Intergenic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
1166690964 19:44821036-44821058 CAGAGGAAGGAAGGGAGGGCTGG - Exonic
925036799 2:693046-693068 CAGCCTAAGGAAGAGCTTGCTGG - Intergenic
925250395 2:2430895-2430917 CAGCAGAAGGAAGAGCAGGCTGG + Intergenic
927907892 2:26875166-26875188 CAGAATAAGGCAGATTGGGAAGG + Intronic
928233862 2:29523103-29523125 CAGGATAAGGAACCCCGGGCAGG + Intronic
928455201 2:31414511-31414533 CAGAACAAGTAAGAGGGGACAGG + Intronic
929379969 2:41337937-41337959 CAGAATAAGGAAGGGAAGGAAGG + Intergenic
930381957 2:50641370-50641392 GAGAAAATGGAAGAGTGGGCAGG + Intronic
932280233 2:70485172-70485194 GAGAAGAAGGAAGAGCGGTAAGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934855974 2:97730518-97730540 CAGGAAAAGCAAGAGAGGGCAGG + Intronic
935023431 2:99253704-99253726 AAGAAAAAGGAAGAGCCTGCTGG - Intronic
935620229 2:105123554-105123576 TAAAATAAGGAAGAGGGGGCTGG + Intergenic
935675776 2:105594077-105594099 CTGGATAAGCAAGGGCGGGCAGG - Intergenic
937863633 2:126732052-126732074 CAAAAGAAGGAAGGGCAGGCTGG + Intergenic
939572276 2:143854659-143854681 GAAAATAAGGGAGAGGGGGCAGG + Intergenic
940038992 2:149339752-149339774 GAGAATAAGGATGAGCAGGGGGG - Intronic
941572302 2:167186693-167186715 CAGCATGAGGAAGAGCAAGCAGG - Intronic
943557189 2:189420035-189420057 GAGAATAAGAAAGAGAGGGAAGG + Intergenic
945182675 2:207107712-207107734 CAGCACAAAGAAGAGCCGGCTGG - Intronic
945981001 2:216310556-216310578 CAGTTTAAGGAAGAACTGGCTGG - Intronic
946371357 2:219283416-219283438 CAGAATCATGGAGAACGGGCAGG + Exonic
946812061 2:223536349-223536371 CAGAATCACGAAGAGCAGTCAGG - Intergenic
947062391 2:226181445-226181467 CAGAATCAGGGAGAGGGGGTAGG - Intergenic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
1172249041 20:33465930-33465952 CAGAACAAGGGAGGGCAGGCGGG + Intergenic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1173139617 20:40470727-40470749 CAGAAATAGGAAGCCCGGGCTGG + Intergenic
1173591034 20:44225082-44225104 CAGCAGAAGGAACAGCGGCCTGG + Intergenic
1174466444 20:50721255-50721277 CAAAAAAAAGAAGAGCAGGCCGG - Intergenic
1177817270 21:25991157-25991179 CAGAATGAGGAAGAGTGGGAAGG + Intronic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178700528 21:34829782-34829804 AAGAGTAAGGAAGAGAGGGAAGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1182403019 22:30097630-30097652 GAGAATAAGGGAGTGTGGGCAGG + Intronic
1182705966 22:32280565-32280587 CAGCATAGGGAAGAGAGGGAGGG - Intergenic
1183225973 22:36550133-36550155 CAGAATAGGGAAGACGGGCCAGG + Intergenic
1183237416 22:36630080-36630102 CAGAAGAAGGCAGTGCGGGAGGG + Intronic
1183769381 22:39910701-39910723 CAGAATAAGAAAGATCTGGCTGG - Intronic
949929791 3:9069650-9069672 CAAAAGTAGCAAGAGCGGGCTGG + Intronic
951441322 3:22727151-22727173 CAGAATAAGGAAGAAAGGAATGG - Intergenic
951744204 3:25959365-25959387 GAGACTAAGGAAGAACGGGTAGG - Intergenic
954144007 3:48625332-48625354 AAGAATAAGCATGACCGGGCCGG - Intergenic
954679175 3:52332402-52332424 CAGAATAGGGAAGGCCGAGCGGG - Intronic
955342861 3:58138871-58138893 TGGAAGAAGGAAGAGCTGGCCGG - Intronic
956130997 3:66053817-66053839 TGGAATAAGAAAGAGGGGGCTGG - Intergenic
958037674 3:88189539-88189561 CAGAAAAAGGAAGAGGGGAGGGG - Intergenic
959445696 3:106435993-106436015 CAGAAAAAGAAAGAGAGGGAGGG + Intergenic
959726360 3:109546558-109546580 CAAAAGAAGAAAGAGAGGGCTGG - Intergenic
960680617 3:120243784-120243806 CAGAATAAGGAGGAGCTGTTAGG + Intronic
960713639 3:120555573-120555595 TAGGATAATGAAGAGAGGGCAGG + Intergenic
960972665 3:123150700-123150722 CTGGAGAAGGAAGAGGGGGCGGG - Intronic
961958412 3:130828060-130828082 CAAAATAAGGAAGATGGTGCTGG + Intergenic
962058872 3:131904262-131904284 CAGAAATAGGAGGAACGGGCTGG - Intronic
963393861 3:144706204-144706226 CAGAGTAAGGAAGAGATGGTTGG + Intergenic
963844047 3:150136969-150136991 CAGACCAAGGAAGAGCAAGCTGG + Intergenic
964162674 3:153664152-153664174 CAGAATAAGCAATAGCTTGCTGG - Intergenic
965920147 3:173903662-173903684 CAGAATATAGAAGAGAGGGTAGG + Intronic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
967799416 3:193639603-193639625 AGGAATAATGAAGAGCGGGGAGG + Intronic
969213847 4:5708170-5708192 AAGAATGAGGAAGGGAGGGCAGG - Intronic
969311299 4:6354266-6354288 GAGACTGAGGAAGAGCAGGCAGG - Intronic
969385388 4:6842883-6842905 CAGAAAAATCAAGAGCGGGCCGG - Intronic
969909796 4:10433319-10433341 CAGAACAAGGAAGATAGGGCAGG - Intergenic
970235956 4:13958166-13958188 AAGAAAAAGGAGGAGCGGGGAGG - Intergenic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
975523743 4:75327351-75327373 CAGGATGGGGAAGAGTGGGCAGG - Intergenic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
979675842 4:123409639-123409661 GAGAAGAGGGAAGAGCGGGAGGG + Intergenic
980202973 4:129678886-129678908 CAGCATAAGGAAGAGTGAGAGGG - Intergenic
980483319 4:133419007-133419029 CAGAATGAGAAACAGTGGGCAGG + Intergenic
982204795 4:152989674-152989696 CAGAAGAAGGAAGAACAGGGAGG + Intergenic
984786426 4:183571653-183571675 CAGAAACAGGAAGTGCTGGCAGG - Intergenic
986572824 5:9182672-9182694 CTGAGTAAGGAAGAGTAGGCTGG - Intronic
986855043 5:11858631-11858653 AAGAATAAGTAAGAACAGGCTGG + Intronic
987863403 5:23511767-23511789 CAAAAGAAGGAAGGGCTGGCAGG + Intronic
987900296 5:24002336-24002358 AAGAAGAAGGATGAGCGGGAAGG + Intronic
990165486 5:52989267-52989289 CGGAATCAGGAGGGGCGGGCTGG + Intergenic
991972675 5:72156111-72156133 GAGAAGCAGGAAGAGAGGGCAGG - Intronic
993772908 5:91953249-91953271 AAGAAAAAGGAAGAAGGGGCAGG + Intergenic
994148437 5:96420727-96420749 GAGAATAAGGAAGGGAGGGAGGG + Intronic
994162173 5:96568945-96568967 CAGAAAATAGAAGAGTGGGCTGG + Intronic
995217544 5:109612872-109612894 CAAAATAAGGAAGAGCTAGAGGG + Intergenic
996165488 5:120217091-120217113 CAGAAAAAGAAAGAGATGGCAGG - Intergenic
998281804 5:140817089-140817111 CAGAATAATAAAGAGCTGGGTGG - Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000001405 5:157142424-157142446 CAGAAGAAGGAAGGGCAGGGAGG + Intronic
1000440482 5:161257180-161257202 CAGCATAGTGAAGAGCTGGCTGG + Intergenic
1002501174 5:179648622-179648644 CAAAATAAGGTAGAGCCGGCTGG - Intergenic
1004061071 6:12198637-12198659 CATAATAAGGATGAGAGTGCTGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005634317 6:27738906-27738928 AAGAAAAAAGAAGAGCGGGCCGG - Intergenic
1005813728 6:29534017-29534039 GAGAAGAAGGAAGAGAGGGAGGG - Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006657933 6:35612695-35612717 CAGAAGAGGGAAGAGCCAGCAGG + Intronic
1007209089 6:40177273-40177295 AAGACGAAGGAAGAGCAGGCAGG + Intergenic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007677516 6:43609141-43609163 CAGAATAAGGCAGAGAGTGATGG - Intronic
1007969200 6:46033607-46033629 CAGAATGAGGAAGGGCTGGCAGG - Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1011175901 6:84559885-84559907 CAAAAAAAGGAAGAGAGGGAAGG - Intergenic
1013366532 6:109441680-109441702 CAGGATAGGGAAGGGCTGGCAGG - Intronic
1014325956 6:119993903-119993925 CTGTATAATGAAGAGGGGGCTGG - Intergenic
1015500159 6:133923297-133923319 CAGAATCAGTGAGAACGGGCAGG - Intergenic
1017711515 6:157172988-157173010 CAGAGTGAGGAAGAGAGGGAAGG - Intronic
1018278273 6:162156580-162156602 CAGAAAATGAAAGAGCAGGCTGG - Intronic
1018998789 6:168729863-168729885 CAGAGTCAGGAAGAAGGGGCTGG - Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019105387 6:169663391-169663413 CAGAATGAGGAAGAGAGTGTAGG + Intronic
1021617475 7:22517713-22517735 AAGAACAAGGAATAGCTGGCTGG - Intronic
1022927061 7:35067127-35067149 AAGAACAAGGAATAGCTGGCTGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024539288 7:50463062-50463084 TAAAATAAGGAAGAGAAGGCCGG - Intronic
1025069127 7:55883674-55883696 AGGAAGAAGGAAGACCGGGCTGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026856262 7:73757167-73757189 CAAAAAAAAGAAGAGAGGGCCGG + Intergenic
1028375202 7:90138397-90138419 AAGAACAAGGAATAGCTGGCTGG + Intergenic
1032152367 7:129440328-129440350 GAGAATAAAGAAGAGTGAGCAGG - Intronic
1032943675 7:136825173-136825195 CAGAATAAGCACCAGCGGGCAGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1035959821 8:4124869-4124891 CAGAAAAAGGAAAAGCGGAGGGG + Intronic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1038420816 8:27433121-27433143 GAGAAAATGGAAGAGGGGGCTGG - Intronic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044422929 8:92019400-92019422 CAGAGAAAGGAAGAGCAGGAGGG + Intronic
1046670305 8:117049723-117049745 CAGAATAAGCAAGAGCCCCCTGG + Intronic
1048306964 8:133291104-133291126 CAGATAAAGGGAGAGCAGGCGGG + Intronic
1048365180 8:133732268-133732290 CAGGATAAGGAAGAGCTCTCTGG + Intergenic
1048431179 8:134372804-134372826 AAGACTATGGAAGAGCAGGCTGG - Intergenic
1053195136 9:36111688-36111710 AAGCATAAGAAAGAGTGGGCTGG - Intronic
1053286354 9:36851826-36851848 CAGAATTAAGAACAGAGGGCTGG + Intronic
1054899407 9:70352193-70352215 CAGAATAAGGAAGATTTTGCAGG - Exonic
1055692715 9:78850801-78850823 TAGAATAAGAAAAAGAGGGCAGG - Intergenic
1056424414 9:86462647-86462669 ATCAATAAGGAAGAGCTGGCCGG + Intergenic
1058052115 9:100416761-100416783 GAAAGTAAGGAAGAGCTGGCCGG - Intergenic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1062321855 9:135994108-135994130 CACAAGAGGGAAGGGCGGGCAGG - Intergenic
1062338720 9:136084044-136084066 CAGCCTGAGGAAGAGCGGGGAGG + Intronic
1187219499 X:17309894-17309916 CACAATAGGGAAGAGAGGTCAGG - Intergenic
1190030219 X:46965156-46965178 CAGAAAAAGGTAGAGATGGCTGG + Intronic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1192418902 X:71010839-71010861 CAGTATAAAGAAGACTGGGCAGG - Intergenic
1192465248 X:71350395-71350417 CAGAATAAAGAAAAGTGAGCCGG - Intergenic
1192473041 X:71416087-71416109 CAGAATAAAGAAAAGTGAGCCGG + Intronic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193637351 X:83968934-83968956 CAGAGTTAGGAAAAGCGGGGGGG + Intergenic
1194561514 X:95427707-95427729 GAGAAGAAGGAAGAGTGGGGAGG + Intergenic
1195333119 X:103822458-103822480 CAGAATAAAGTAGAGATGGCTGG + Exonic
1197607201 X:128597951-128597973 TAGAAGAAGGAAGAGCAGGGTGG - Intergenic
1199308730 X:146297879-146297901 GAGAAGAAGGAAGAGTGGGGAGG - Intergenic