ID: 1178574788

View in Genome Browser
Species Human (GRCh38)
Location 21:33776306-33776328
Sequence CTTTGAGAGGGCAAGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76871
Summary {0: 1, 1: 7, 2: 432, 3: 7935, 4: 68496}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178574776_1178574788 30 Left 1178574776 21:33776253-33776275 CCCATAAGAAACTGTCAGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG 0: 1
1: 7
2: 432
3: 7935
4: 68496
1178574778_1178574788 29 Left 1178574778 21:33776254-33776276 CCATAAGAAACTGTCAGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 162
Right 1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG 0: 1
1: 7
2: 432
3: 7935
4: 68496
1178574782_1178574788 -8 Left 1178574782 21:33776291-33776313 CCTGTAAACCCAATACTTTGAGA 0: 2
1: 94
2: 3104
3: 48383
4: 352118
Right 1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG 0: 1
1: 7
2: 432
3: 7935
4: 68496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178574788 Original CRISPR CTTTGAGAGGGCAAGGTAAG AGG Intronic
Too many off-targets to display for this crispr