ID: 1178575777

View in Genome Browser
Species Human (GRCh38)
Location 21:33788647-33788669
Sequence CTTGAACTTCATCACGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178575774_1178575777 10 Left 1178575774 21:33788614-33788636 CCAGCTGCTCGGGAGGCTGAGGC 0: 2560
1: 104770
2: 266022
3: 219174
4: 198698
Right 1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 101
1178575772_1178575777 11 Left 1178575772 21:33788613-33788635 CCCAGCTGCTCGGGAGGCTGAGG 0: 2765
1: 111227
2: 293718
3: 226548
4: 225970
Right 1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 101
1178575770_1178575777 19 Left 1178575770 21:33788605-33788627 CCTGTAATCCCAGCTGCTCGGGA 0: 1176
1: 50701
2: 217103
3: 270078
4: 495126
Right 1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178575777 Original CRISPR CTTGAACTTCATCACGGCAG AGG Intronic
901238919 1:7681710-7681732 CTTGAAGTTCAGCACGGCCCTGG - Intronic
901649136 1:10733387-10733409 CATGAGCTTCCTCTCGGCAGTGG - Intronic
904743639 1:32697352-32697374 CTTGAACTTCAAAGAGGCAGAGG + Intronic
904966136 1:34374898-34374920 TTTGAACTTCATCTAGGTAGTGG + Intergenic
905412336 1:37779264-37779286 CAAGAACTTCATCACAGCCGAGG + Intergenic
909209057 1:72799335-72799357 TTTGAACTACATCACGACACAGG - Intergenic
909403300 1:75258339-75258361 CTTGAGCTTCGTCAGGGAAGGGG + Intronic
910924694 1:92386373-92386395 CTTGAACTTCATCCTGACTGAGG + Intronic
912929197 1:113941282-113941304 CTTGAGCTTCATCAAGGCTGTGG - Exonic
914293639 1:146298162-146298184 CTTGAACTTCATCATAGAGGCGG - Intergenic
914554683 1:148748945-148748967 CTTGAACTTCATCATAGAGGCGG - Intergenic
917487635 1:175469250-175469272 ACTGAACTTCTTCAAGGCAGAGG - Intronic
917748606 1:178034942-178034964 CTTTAGCTTCATGAAGGCAGAGG - Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1063749026 10:8921306-8921328 CTTGAACCTCACCATAGCAGTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1071261675 10:83925280-83925302 CCTGAATTTCCTCACAGCAGGGG - Intergenic
1085498297 11:76993120-76993142 CCTGAGCTTCACCAAGGCAGGGG - Intronic
1088899200 11:114102456-114102478 CTTCTCCTTCATCACAGCAGTGG + Intronic
1097849098 12:64394059-64394081 CTTGAATTTCATCAGAACAGTGG + Intergenic
1099672056 12:85706666-85706688 CTTTAACTTTATTATGGCAGAGG + Intergenic
1100309188 12:93378315-93378337 CTTGAACTTCATCATAGAGGCGG - Exonic
1104999361 12:132679541-132679563 CCTGTTCTTCTTCACGGCAGGGG + Exonic
1111956529 13:94765152-94765174 CTTGAACTTCATCAATGCCCAGG - Intergenic
1112623889 13:101080093-101080115 CTTGATCTTCATAATGCCAGAGG + Intronic
1115376945 14:32686812-32686834 CTGGAACTTCACCACAGGAGTGG - Intronic
1116515748 14:45803018-45803040 TTTGAGCTTCATGAAGGCAGAGG - Intergenic
1117546933 14:56801064-56801086 CTTGAACTCCACCTCTGCAGGGG - Exonic
1119544982 14:75465037-75465059 CTTGAACTTCATCAATGGATAGG - Intronic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122924690 14:104894184-104894206 GATGAACTTCACCATGGCAGAGG + Intronic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1132195539 15:99912134-99912156 TTTGAACTTCCTCACAGCTGGGG + Intergenic
1137270843 16:46901441-46901463 CTGGAACTCCATCACCGCAGGGG - Intronic
1138163285 16:54776307-54776329 CTGCAACATCATCACAGCAGAGG - Intergenic
1159861116 18:73650862-73650884 CTTGGACTCCACCACAGCAGTGG - Intergenic
1160456826 18:79007430-79007452 CTTCTACTTCATCACAGCACAGG - Intergenic
1164550350 19:29205961-29205983 CTTGAAATTCTACATGGCAGTGG - Exonic
1164742684 19:30588250-30588272 GTTGAGCATCACCACGGCAGTGG + Intronic
1165830789 19:38729270-38729292 CCAGAACTTCATCACAGCTGAGG + Exonic
1166855955 19:45782712-45782734 CTTGAAATTCATCACACCTGTGG - Intronic
1167823992 19:51955140-51955162 CTAGAACTTCATAGGGGCAGAGG - Intergenic
926003150 2:9350615-9350637 TTTGAACTTCATCTCCACAGAGG - Intronic
935059041 2:99592435-99592457 CTTGAACTTCATGAGGCCACTGG + Intronic
945682329 2:212928824-212928846 CTTTAATTTCATCACACCAGTGG - Intergenic
1171086840 20:22245435-22245457 GGTGAACTTCAGCACAGCAGAGG + Intergenic
1171187531 20:23133424-23133446 CCTGAACTTCATCATCCCAGTGG + Intergenic
1171329249 20:24323034-24323056 CTTGACCTTCCTGAGGGCAGTGG - Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
950274091 3:11643609-11643631 CTTCAACTTCACAAAGGCAGAGG + Exonic
953353542 3:42234293-42234315 CGTGAACTTCAACAGGGCAGGGG - Intergenic
965782774 3:172305131-172305153 CTTCAAAATCATCAGGGCAGGGG - Intronic
970652761 4:18196839-18196861 CTTGCATTTCTTCACGGCACTGG - Intergenic
974263972 4:59560447-59560469 CTTGAACTTCATTGGGGGAGGGG - Intergenic
974286786 4:59879178-59879200 CTTGCATTTCTTCACGGCACTGG + Intergenic
977391887 4:96420996-96421018 CCAAAACTTCATCACAGCAGTGG - Intergenic
979099729 4:116599450-116599472 CAAGAACTTCATCACAGCTGAGG + Intergenic
982339870 4:154285470-154285492 CTTGAACTGCCCCAAGGCAGAGG + Intronic
990033668 5:51292822-51292844 CTAAAGCTTCATCACAGCAGAGG + Intergenic
997032821 5:130151586-130151608 CTTGCAGTTCAGCACGGCTGGGG + Intronic
997801420 5:136866333-136866355 CTTGAGCTTCTTCCCTGCAGTGG + Intergenic
999179092 5:149656241-149656263 TTTGAACTTGAGCAAGGCAGTGG + Intergenic
1002458136 5:179357677-179357699 CTTGCACTCCAGCAGGGCAGTGG + Intergenic
1003963611 6:11232504-11232526 CTTATACTTCATTTCGGCAGCGG + Exonic
1006861001 6:37171271-37171293 CTTCGACTTCATCACGGAAAGGG + Exonic
1010041824 6:71393536-71393558 CCTGATGTTCATCAGGGCAGTGG - Intergenic
1010943502 6:81947918-81947940 ATTCAACTTCATAAAGGCAGAGG + Intergenic
1011145480 6:84210349-84210371 CTTTAACTCCAACATGGCAGAGG - Intronic
1013766054 6:113575336-113575358 TTCCAACTTCAACACGGCAGTGG - Intergenic
1016236061 6:141868302-141868324 ATTGAGCTTCCACACGGCAGTGG + Intergenic
1016553563 6:145309805-145309827 CTTGAACTTCATCTGTACAGAGG + Intergenic
1019410400 7:904240-904262 CTCGATCTTCATCACGGCCTTGG + Exonic
1020044484 7:5031006-5031028 TTTGGACTTCATCACAGCTGGGG + Intronic
1020289842 7:6715028-6715050 TTTGGACTTCATCACAGCTGGGG + Intergenic
1023825863 7:44008348-44008370 TTTGGACTTCATCACAGCTGAGG - Intronic
1026089433 7:67287199-67287221 TTTGGACTTCATCACAGCTGGGG - Intergenic
1026724848 7:72863301-72863323 TTTGGACTTCATCACAGCTGGGG + Intergenic
1026746979 7:73021497-73021519 TTTGGACTTCATCACAGCTGGGG + Intergenic
1026750631 7:73049640-73049662 TTTGGACTTCATCACAGCTGGGG + Intergenic
1026754278 7:73077750-73077772 TTTGGACTTCATCACAGCTGGGG + Intergenic
1026757930 7:73105783-73105805 TTTGGACTTCATCACAGCTGGGG + Intergenic
1027033083 7:74906068-74906090 TTTGGACTTCATCACAGCTGGGG + Intergenic
1027089473 7:75287701-75287723 TTTGGACTTCATCACAGCTGGGG - Intergenic
1027093118 7:75315629-75315651 TTTGGACTTCATCACAGCTGGGG - Intergenic
1027096761 7:75343596-75343618 TTTGGACTTCATCACAGCTGGGG - Intergenic
1027119028 7:75502517-75502539 TTTGGACTTCATCACAGCTGGGG - Intergenic
1027272798 7:76533091-76533113 TTTGGACTTCATCACAGCTGGGG + Intergenic
1027322586 7:77024084-77024106 TTTGGACTTCATCACAGCTGGGG + Intergenic
1028991017 7:97049046-97049068 CATGACCTTCAGCAAGGCAGTGG + Intergenic
1031390840 7:121212620-121212642 CTAGAACTCCATGAGGGCAGGGG + Intronic
1033256866 7:139808770-139808792 CATGAACTTCTTGAGGGCAGAGG + Intronic
1033666697 7:143447330-143447352 CTTAAACTTCTTAACGGCATGGG + Intergenic
1035075574 7:156175223-156175245 CTTGAACATCCTCACCGCCGAGG + Intergenic
1035098563 7:156377595-156377617 CTGGGACTTCAGCACTGCAGAGG + Intergenic
1036646114 8:10612187-10612209 CCTGCACTTCATCCCAGCAGGGG - Exonic
1043931528 8:86096878-86096900 CTTGATCTTCATAAAGGGAGTGG + Intronic
1045280933 8:100749254-100749276 CTTGAACCTCCTCTCTGCAGAGG - Intergenic
1045856473 8:106770390-106770412 CTCCAGTTTCATCACGGCAGAGG + Intergenic
1049271165 8:141697017-141697039 CTTGGTTTTCATCACCGCAGGGG + Intergenic
1051699566 9:19807177-19807199 CTTGAACTTCATAACCCAAGTGG + Intergenic
1057092358 9:92270246-92270268 CTTCAACTTCAACACAGAAGAGG + Intronic
1061437674 9:130576327-130576349 ATTAAACTTTATCAGGGCAGAGG - Intergenic
1187018888 X:15359232-15359254 TTTTAACTTCATCATGGAAGTGG - Intronic
1188333973 X:28905725-28905747 CGTAAACTCCATCAAGGCAGAGG - Intronic
1188919692 X:35957383-35957405 TATGAACTGCATCACTGCAGTGG - Intronic
1189556414 X:42150157-42150179 CCTGAACATCATCTCAGCAGAGG - Intergenic