ID: 1178584014

View in Genome Browser
Species Human (GRCh38)
Location 21:33858064-33858086
Sequence TCAACCACACAGAGCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178584011_1178584014 8 Left 1178584011 21:33858033-33858055 CCACTGAGATCTGTGATTTACTG 0: 1
1: 0
2: 3
3: 24
4: 177
Right 1178584014 21:33858064-33858086 TCAACCACACAGAGCTTGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178584014 Original CRISPR TCAACCACACAGAGCTTGGA GGG Intronic
901856628 1:12048536-12048558 TCAACTCCAGAGAACTTGGAAGG - Intergenic
902975594 1:20085978-20086000 TCTCCCACCCAGGGCTTGGAGGG - Intronic
903807453 1:26015689-26015711 TAATCCTGACAGAGCTTGGAAGG - Intergenic
904061341 1:27713326-27713348 TCAACCACGCAGACAGTGGAAGG + Intergenic
904224482 1:29004332-29004354 TCATCCACACAGAAAATGGATGG - Intronic
907870757 1:58440558-58440580 TTAACCTCTCTGAGCTTGGATGG + Intronic
908473634 1:64469225-64469247 GCAACCACACAGGGCTTGGAAGG + Intergenic
910421794 1:87072488-87072510 TCAAACACACAAAGATTGCATGG - Intronic
911824515 1:102464615-102464637 TCAAGGTCACAGAGCTAGGAAGG + Intergenic
916438864 1:164802367-164802389 ACAACCAGAACGAGCTTGGAAGG - Intronic
918900741 1:190413543-190413565 TCAAGGAGACAGAGATTGGAGGG + Intronic
919538668 1:198820859-198820881 TCAACCACACAGGCCTTAGCAGG - Intergenic
919859099 1:201726992-201727014 CCAAACTCACAGAGCTAGGAAGG - Intronic
921785893 1:219229359-219229381 AGAACCACGCAGAGCTTGGCTGG + Intergenic
1064472983 10:15656111-15656133 TCTAACACAGAGAGTTTGGATGG - Intronic
1065433141 10:25680332-25680354 TCAAACACAGAAAGCTTGGAGGG - Intergenic
1067333371 10:45341817-45341839 TATCCCACACATAGCTTGGAGGG + Intergenic
1067566376 10:47340626-47340648 TCACCCACACAGTGGTTGGGTGG - Intergenic
1069719407 10:70539927-70539949 ACACACACACAAAGCTTGGAAGG - Intronic
1069737815 10:70669103-70669125 TCAACTCCACAGGACTTGGAGGG + Intergenic
1071534758 10:86419229-86419251 TCAAACCCACAGAGCGTAGAAGG + Intergenic
1072609911 10:97011163-97011185 TCAGCCACACAGAGTCTGGGAGG + Intronic
1073480044 10:103780603-103780625 TCAGCAACACAGGGCCTGGATGG - Intronic
1074833378 10:117265587-117265609 AGGACCACACACAGCTTGGATGG + Intronic
1076423745 10:130352434-130352456 ACAGCCACACAAAGCTGGGATGG - Intergenic
1076510612 10:131011543-131011565 CCAACCAGACAGGACTTGGAAGG + Intergenic
1078049173 11:7946648-7946670 ACAGCCACACAGAGAATGGAAGG - Intergenic
1079257861 11:18848203-18848225 TCAAACTCACAGAACTGGGAAGG + Intergenic
1080389194 11:31828068-31828090 TCAATCAAACAGACCTTTGATGG + Intronic
1080424847 11:32146104-32146126 TCAACTCCTCAGAGTTTGGAGGG - Intergenic
1081567288 11:44267801-44267823 TCATCCACTCTGAGCTGGGAAGG + Intronic
1081598166 11:44473535-44473557 CCAACGGCACAGAGGTTGGAGGG + Intergenic
1084835459 11:71798874-71798896 ACACACACACAGAGCTTAGAAGG - Intronic
1085281653 11:75334907-75334929 TAAAGCTTACAGAGCTTGGAAGG + Intronic
1085545451 11:77313578-77313600 TCTACAACGCAGAGCGTGGACGG - Intergenic
1085691495 11:78667896-78667918 TCAACCCCACAGAGAGTGGGTGG - Intronic
1086404836 11:86490661-86490683 ACATACATACAGAGCTTGGAAGG + Intronic
1088807523 11:113365848-113365870 ACAACCAGACAGAACTTGAAAGG - Intronic
1090735354 11:129608278-129608300 TCAATCACACTGTCCTTGGATGG + Intergenic
1091076360 11:132621482-132621504 TAAAACACACACAGCATGGAAGG + Intronic
1091207115 11:133829404-133829426 TCCACCACCCAGAGCTTTGAAGG - Intergenic
1093971131 12:25377097-25377119 GCAACCACACCAAGCCTGGAGGG - Intergenic
1094329974 12:29280727-29280749 TCATCCAGAGAGACCTTGGATGG - Intronic
1095989368 12:48023822-48023844 ACAACCACAGAGAGGCTGGAAGG + Intronic
1098063214 12:66584854-66584876 TCATCCACAGAGAGTATGGAGGG - Intronic
1102017991 12:109661111-109661133 CCCACCACACAGAGCCAGGATGG + Intergenic
1102198371 12:111040509-111040531 CCAACCACAGAGAGATGGGAGGG - Intronic
1109362301 13:61310671-61310693 TGAACCACACAGAGTTTTCATGG - Intergenic
1110463787 13:75778121-75778143 TCAACCACAGACAGCTTTAAAGG - Intronic
1113531830 13:111032785-111032807 TCAACCCTCCAGAGCTTGTAAGG - Intergenic
1117564335 14:56977974-56977996 TCAAGCCCACAGGGCTAGGAGGG - Intergenic
1119656433 14:76420712-76420734 CAAAACACACAGAGGTTGGAGGG + Intronic
1120764996 14:88320888-88320910 CCAACAACACAGGGCTTGGAGGG + Intronic
1121123654 14:91392382-91392404 TCAACCACCCAGAGCAGGGAAGG + Intronic
1121563988 14:94895027-94895049 TTAACCAGAAAGATCTTGGATGG + Intergenic
1121710013 14:96030700-96030722 TCAGCCACACAGAGCTGGTGAGG - Intergenic
1121959141 14:98242293-98242315 ACAACAACACAGAGAATGGACGG + Intergenic
1122136287 14:99634901-99634923 TCAAACACACACAGACTGGAGGG + Intergenic
1124079154 15:26475225-26475247 ACAACCACACAGGGCAGGGAAGG + Intergenic
1124399694 15:29337358-29337380 TCCACCTCAGAGAGCTGGGAGGG + Intronic
1124840203 15:33234469-33234491 ACAGCCACACGGAGCCTGGATGG - Intergenic
1125038571 15:35156490-35156512 TCCCACACACAGAGCTTGAAAGG - Intergenic
1129782356 15:78281102-78281124 TCCTCACCACAGAGCTTGGAAGG - Exonic
1133155275 16:3870269-3870291 TCAGCTACACAGATCTTGAAAGG - Intronic
1135223655 16:20636895-20636917 TAAACCAGACAGTGCTTGGGTGG - Intronic
1136987711 16:35126249-35126271 ACACACACACAGAGATTGGAAGG + Intergenic
1137464410 16:48695172-48695194 CCAGCCACACTGAGTTTGGAAGG + Intergenic
1140991793 16:80220031-80220053 TATACCACACATGGCTTGGAGGG + Intergenic
1141373554 16:83508974-83508996 TCATGCACACAGAGCTGTGATGG - Intronic
1143382196 17:6503429-6503451 TCATCCACTCAGAGCCTGAAAGG - Intronic
1147760723 17:42795914-42795936 TCATCCACACTGGGCTGGGATGG - Exonic
1148752421 17:49952911-49952933 TCACCCACCCTGAGCTTGGAAGG - Intergenic
1150060866 17:62066835-62066857 TAAAACACCCAGTGCTTGGATGG + Intergenic
1150311846 17:64135404-64135426 TAAACCACACAGAATCTGGAAGG - Intergenic
1152662711 17:81550385-81550407 TCCACCACACAGAGGTCAGAAGG + Exonic
1157096090 18:44686546-44686568 TCAAGGGCTCAGAGCTTGGAGGG - Intronic
1165919365 19:39284533-39284555 TAAAATACACAGAGATTGGAAGG - Intergenic
925286129 2:2716885-2716907 GACGCCACACAGAGCTTGGAAGG + Intergenic
926419356 2:12681713-12681735 TGGACCACACAGAGCTTTGAAGG + Intergenic
927899710 2:26810610-26810632 CCAACCAGACAGAGCATGGGGGG + Intergenic
928423652 2:31160067-31160089 TGAACCACAGAGAGCCAGGACGG + Intergenic
935946497 2:108291078-108291100 ACAACCAGAATGAGCTTGGAAGG - Intronic
938097759 2:128474582-128474604 TCTGCCACACGGAGCTGGGAGGG - Intergenic
939713329 2:145551548-145551570 ACAACCACACAGAGCTTCTTCGG + Intergenic
945906488 2:215599589-215599611 TCCACCTCACAGAGCTAGGCAGG - Intergenic
946075103 2:217067215-217067237 AGAAACACACAGAGCTTAGACGG + Intergenic
946705176 2:222451485-222451507 TCAGCCACACAGAGCGTGTAGGG - Intronic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1175656356 20:60774482-60774504 TCAGCAAGACAGAGCCTGGAAGG - Intergenic
1178157645 21:29873485-29873507 TCAACCACATAGAGCTGTGAGGG + Intronic
1178584014 21:33858064-33858086 TCAACCACACAGAGCTTGGAGGG + Intronic
1184573870 22:45346413-45346435 CAAACCACTCAGAACTTGGACGG + Intronic
1185051346 22:48555861-48555883 TCAAGTACACAGACCTGGGAGGG + Intronic
952654134 3:35763564-35763586 GGAACCACATGGAGCTTGGACGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
957313691 3:78550859-78550881 TCAACCAAACACATCTTGGAAGG + Intergenic
957627872 3:82678243-82678265 TCAACCACACAGAACCGGTAGGG + Intergenic
957679713 3:83418221-83418243 TCAACCACTCAGTGCATGGCTGG - Intergenic
960611368 3:119557865-119557887 CAAAACACACAGAGATTGGAGGG + Exonic
962234216 3:133693841-133693863 TCACCCACACGGAGGCTGGAAGG - Intergenic
963907385 3:150783837-150783859 TCAAACACACATAGGTTTGAAGG - Intergenic
966088490 3:176101399-176101421 TCAACCACAGAGAGTTTTAAAGG + Intergenic
970208999 4:13687806-13687828 TCAACCACACAGAGTGGGCAGGG + Intergenic
972711475 4:41600431-41600453 TCACACACACATTGCTTGGAGGG + Intronic
976708502 4:88043479-88043501 ACAACCACACAGAAATAGGAGGG - Intronic
980190748 4:129521494-129521516 CCAACCACACAGAGCCCTGATGG - Intergenic
990801346 5:59607582-59607604 GCAAACACAGTGAGCTTGGAGGG + Intronic
992522504 5:77569473-77569495 TCAACCACCCAGAGCTCTCATGG + Intronic
993279999 5:85913278-85913300 TCAACCTCAAAAAGCTAGGAAGG + Intergenic
993617353 5:90129984-90130006 TGAACGAGACAGAGTTTGGATGG - Intergenic
998139974 5:139694211-139694233 TCAACCACACCCATCCTGGATGG - Intergenic
1000190596 5:158906699-158906721 CCAACCTCACAGAGCCAGGAAGG + Intronic
1000420801 5:161035864-161035886 TGTAACCCACAGAGCTTGGAAGG - Intergenic
1002805239 6:567312-567334 ACAACCACACAGAGGATGGGGGG - Intronic
1003612991 6:7630114-7630136 TCAACCACATGGAGAGTGGAAGG - Intergenic
1011692053 6:89879297-89879319 TCAAGAACACAAAGCTTGGCAGG + Intergenic
1012591773 6:100990507-100990529 TTAACCAAACAGAGCATGGATGG - Intergenic
1012997413 6:105987078-105987100 TCAATCTCACAGAGCTTGTTTGG + Intergenic
1014512622 6:122343050-122343072 TTAACCTCTCAGAGATTGGAGGG + Intergenic
1014640637 6:123905257-123905279 TCAACCCCAAAGCACTTGGAGGG - Intronic
1015496407 6:133888486-133888508 CCAACCACACACAGCTTAGTGGG - Intergenic
1016022811 6:139253887-139253909 TTCACCACACAGAGCCTTGAGGG - Intronic
1018971383 6:168531761-168531783 CCAAGCACAGAGACCTTGGAAGG - Intronic
1020688663 7:11327489-11327511 TCAATCACACAGGTCTTGGGGGG + Intergenic
1020894624 7:13924289-13924311 TCAAGGACTTAGAGCTTGGAAGG + Intronic
1022834054 7:34096984-34097006 TCTAGCTCACAGAGCTTGCAGGG + Intronic
1023161069 7:37296301-37296323 TCAACCTCTCAGAGCTGAGAGGG - Intronic
1027665719 7:81041548-81041570 TAGAACTCACAGAGCTTGGAAGG + Intergenic
1032955684 7:136969541-136969563 AAAACAACACAGAACTTGGAAGG - Intronic
1034079593 7:148263809-148263831 TCAACCACGCAGACATAGGAAGG + Intronic
1034980518 7:155473091-155473113 TCCCCCACAGAGAGCTTGGAAGG + Intergenic
1034999160 7:155597652-155597674 CCAACCCCAGACAGCTTGGATGG - Intergenic
1037855027 8:22365858-22365880 TCCAACACACAGAGCTCTGAAGG - Intergenic
1038814995 8:30893224-30893246 CCAAGGACACAGAGCTAGGAAGG + Intergenic
1044509725 8:93060402-93060424 TCAATCCCACAGAGCTGAGATGG - Intergenic
1045388194 8:101690730-101690752 GCCAGCACACAGAGCTTGGAGGG - Intronic
1045832660 8:106482452-106482474 TCAACATCACAGAGCTTTGCAGG - Intronic
1048577233 8:135702268-135702290 ACAGCCACACAGAGAATGGAAGG - Intergenic
1050709660 9:8447045-8447067 GCCACAACATAGAGCTTGGATGG + Intronic
1053482498 9:38425904-38425926 TCAGCCACACAGAGCAGGGGCGG + Intergenic
1056715223 9:89023001-89023023 ACAACCATAAACAGCTTGGAAGG + Intronic
1058977293 9:110136805-110136827 TCATCCTCAAAGAGCTTGGAGGG - Exonic
1059773066 9:117445934-117445956 TCCACCACACTGAGATTGGGTGG + Intergenic
1060101012 9:120841281-120841303 TCAACAACACAGAGATTGGCCGG + Intronic
1062195035 9:135268308-135268330 CCAGCCACACAGAGCTTCCAGGG + Intergenic
1186368666 X:8924001-8924023 TGAACTACACAGAGCTGGCATGG + Intergenic
1186931791 X:14399959-14399981 TCAACTTCACAGAGCTTTGATGG + Intergenic
1188619862 X:32207115-32207137 ACTACCACACAGGGCTTGGGAGG - Intronic
1189276643 X:39791119-39791141 ACAACCACAGAGAGCTTGACAGG + Intergenic
1193724616 X:85024683-85024705 TCAGTCACACAGAGCTATGAGGG + Intronic
1197120589 X:122886311-122886333 TGAACCATACAGAGGATGGAAGG + Intergenic
1197462814 X:126763354-126763376 TCAACAAAACAGAGCTTAGTTGG + Intergenic