ID: 1178585315

View in Genome Browser
Species Human (GRCh38)
Location 21:33866451-33866473
Sequence GCTGACACCAGCCCAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178585311_1178585315 25 Left 1178585311 21:33866403-33866425 CCGAGCAAGATGAGTTCATTGTT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 307
1178585310_1178585315 26 Left 1178585310 21:33866402-33866424 CCCGAGCAAGATGAGTTCATTGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178585315 Original CRISPR GCTGACACCAGCCCAGAGCA GGG Intronic
900148679 1:1168966-1168988 GCAGACACCAGCCCAGGACCCGG + Intergenic
901347896 1:8563464-8563486 CCTGCCACCAGCTCACAGCAGGG + Intronic
901626950 1:10629998-10630020 GCTGCCTCCAGCCCTGAGGATGG + Exonic
901671158 1:10857071-10857093 GCTGTCAGCAGCCCAGGGCCAGG - Intergenic
901744659 1:11364256-11364278 CCTGACCCCTGCCCAGAGCAAGG - Intergenic
901874898 1:12161860-12161882 GGTGCCCCCAGCCCACAGCATGG + Intergenic
902301850 1:15507550-15507572 GGTGGCCCCAGCACAGAGCATGG + Intronic
902702703 1:18183515-18183537 GCTGGCACAAGCCCAGGTCATGG + Intronic
902776078 1:18675892-18675914 GCTGTCACCTGCCCTGATCAGGG - Intronic
902957918 1:19939237-19939259 GATGACACTAGGACAGAGCAGGG - Intergenic
905385275 1:37598992-37599014 GAAGACACCAGTCCAGAACATGG - Intergenic
906673322 1:47675991-47676013 GCTCACACCAGCCCAGTTCAGGG - Intergenic
909431391 1:75590993-75591015 CCTGATGCCAGCCCAGTGCAGGG - Intronic
911262361 1:95701666-95701688 TCTTAGACCAGCCCAGAGCCAGG + Intergenic
912181023 1:107219694-107219716 CCTGGTACCAGCCCAGAGCTGGG - Intronic
912493438 1:110075878-110075900 GCTGCCCCCAGCCCAAAGCTGGG - Intergenic
912752981 1:112300887-112300909 GCAAACACCATCCCAGGGCAGGG - Intergenic
913535828 1:119771203-119771225 GCTGGCCCGAGGCCAGAGCAGGG - Intergenic
914339645 1:146749070-146749092 GCTGACACCACCCCAGCAGAGGG + Intergenic
914756001 1:150561955-150561977 ACTGACGTCAGCCCAGGGCAGGG + Intergenic
915042620 1:152981646-152981668 GCTGGCACCAGCCCGGAGCAAGG + Intergenic
915325574 1:155079927-155079949 CCTGACACCCGCCCAGACCGCGG - Intronic
915563209 1:156699737-156699759 CCCCAAACCAGCCCAGAGCAGGG - Exonic
917387354 1:174491625-174491647 TCTGACACCAGCCCAGCACAAGG + Intronic
918042866 1:180923819-180923841 GCTGAGAACACCCCAGGGCACGG + Intronic
920004993 1:202826593-202826615 GCTGAGATCAGCCCAAATCAAGG + Exonic
920800011 1:209177445-209177467 CCTGGTACCAGCCCAGAGCCTGG + Intergenic
920854225 1:209650457-209650479 TCTGTCAGCAGCCCAGAGGAGGG + Intronic
921163719 1:212491070-212491092 GCTGACACCAGCCAGGAGCCGGG - Intergenic
921836197 1:219781526-219781548 GCTGAGACCAGCACAGAGCCTGG + Intronic
922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG + Intronic
924576466 1:245285146-245285168 GCTGAACCCAGCCCACAGCGGGG - Intronic
1062771328 10:104056-104078 GCTGACACCAGCTCTCTGCAAGG + Intergenic
1063616776 10:7607171-7607193 GCTGACACCTGTCTAGAGCAAGG - Intronic
1064547582 10:16466201-16466223 GCAGGCAGCAGACCAGAGCAAGG + Intronic
1066050839 10:31633387-31633409 GCAGAGACCAACCCAGAGCAGGG + Intergenic
1068443911 10:57095669-57095691 GCTGACAGCAGCACAGACCCAGG + Intergenic
1068983814 10:63088689-63088711 GCTGACACCAGCCCTGCCAAAGG - Intergenic
1070589977 10:77794656-77794678 GCTGACACCACCTCTGAGTAGGG + Intronic
1070765874 10:79056122-79056144 CCTGACACTGCCCCAGAGCAGGG - Intergenic
1072769195 10:98123623-98123645 CCTGGTACCAGCCCAGAGCCTGG - Intergenic
1075222999 10:120600806-120600828 GTGGGCACCAGCACAGAGCAGGG - Intergenic
1075324827 10:121522927-121522949 GCTGTTTCCAGCCCAGTGCATGG - Intronic
1075385065 10:122049547-122049569 GCAGACCCCATCCCAGAACAAGG + Intronic
1076160661 10:128242284-128242306 GCAGACACCAGCCTAGAGTCTGG + Intergenic
1076338344 10:129725663-129725685 GCTGTAGCCTGCCCAGAGCATGG - Intronic
1076779243 10:132714949-132714971 GCCAACACCTGCCCAGAGCCTGG - Intronic
1077162439 11:1119885-1119907 GCTTAAACCAGCCCTGAGCACGG - Intergenic
1077373737 11:2195579-2195601 TCAGACCCCAGCCCTGAGCAAGG + Intergenic
1077612865 11:3655136-3655158 CCTGAGCCCAGCCCAGAGCAAGG - Intronic
1079131229 11:17747967-17747989 GCTGACAGCAGCCCCTGGCAGGG - Intronic
1080857685 11:36126350-36126372 GCTTACACCCACCAAGAGCAGGG + Intronic
1081602670 11:44506230-44506252 TCTAACTCCAGCCCAGAGCAGGG + Intergenic
1081763721 11:45594713-45594735 GCCGACCCCAGGCCAGAGGACGG - Intergenic
1082679863 11:56153945-56153967 CCTAGCACCAGCCCAGAGCCTGG + Intergenic
1084365658 11:68696057-68696079 TCTGACACCACCCCAATGCATGG - Intergenic
1085409293 11:76281935-76281957 GCTGACACAGGCCCAGGGAAGGG + Intergenic
1086566354 11:88231148-88231170 TCTCACAGCAGCCCACAGCAGGG + Intergenic
1089134526 11:116238585-116238607 GCAGACACCTGCCGTGAGCAAGG + Intergenic
1089343505 11:117775622-117775644 GCTGTCAACACGCCAGAGCATGG + Intronic
1089399283 11:118155169-118155191 AGTGACCCCTGCCCAGAGCAGGG + Intergenic
1089747275 11:120626210-120626232 GCTGTCAGCAGCCCAGGGGAGGG + Intronic
1089807506 11:121104700-121104722 GCTTCCATCAGCACAGAGCAGGG + Intronic
1090463281 11:126910855-126910877 GCTGACATCATCTGAGAGCAAGG - Intronic
1091382960 12:74649-74671 TCTGATGCCAGCACAGAGCACGG - Intronic
1091785706 12:3242304-3242326 ACCCACACCAGCCTAGAGCAGGG - Intronic
1092856068 12:12674951-12674973 CCTGACCCCAGCCCAGGGGAGGG - Intronic
1092958146 12:13569321-13569343 GCTGAGATCATCCCAGAGTATGG + Intronic
1094819978 12:34216729-34216751 GCTGATACCACCCCAAAGCCTGG + Intergenic
1098569054 12:71968538-71968560 GCTGCCACCACTTCAGAGCAGGG - Intronic
1100516420 12:95332603-95332625 GCTGACATAGGCCGAGAGCAAGG - Intergenic
1100575455 12:95887958-95887980 GGGTACACCAGCCCAGAGGAAGG - Intronic
1101431732 12:104632745-104632767 ACTGTCACCAGCCCAGGTCAGGG - Intronic
1101575587 12:105993803-105993825 GCTGACCCCAGCCCATCCCAGGG - Intergenic
1102021541 12:109686781-109686803 CCTGGTACCAGCCCAGATCAAGG - Intergenic
1102627269 12:114245099-114245121 GCAGACAGCAGCACTGAGCATGG - Intergenic
1103001189 12:117386517-117386539 CCTGACCCCAGCTCAGACCAGGG - Intronic
1103249805 12:119489832-119489854 TCTGTCACCAGGCCAGAGTACGG + Intronic
1103736309 12:123063119-123063141 GCTGACCCCTGCTCAGGGCAAGG + Intronic
1106662960 13:31821562-31821584 GCTGGCAGAAGCCCAGAGCCAGG - Intergenic
1107387987 13:39933255-39933277 GATGTCAGCAGCCCAGAGCTGGG + Intergenic
1113272274 13:108686503-108686525 GATGACACCAGGCCAGAACAGGG + Intronic
1113924882 13:113935850-113935872 GCTGACACTAGGCCCAAGCATGG - Intergenic
1115573175 14:34686293-34686315 GATGACAGCAGCCCGGACCAGGG + Intergenic
1118603071 14:67483785-67483807 GGAGACACCAGCCAAGAGCAGGG + Intronic
1119425506 14:74532295-74532317 GCCGACACAGGCCCTGAGCATGG + Intronic
1119511539 14:75215501-75215523 GCTTCCAGCAGCCCGGAGCATGG + Intergenic
1119684997 14:76624376-76624398 TCTTCCACCAGCCCAGAGCTGGG - Intergenic
1121759872 14:96435764-96435786 GCTGATGCCAGCCCAGCCCATGG - Intronic
1121974874 14:98393739-98393761 GCTGATACCACCCAAAAGCATGG + Intergenic
1122613250 14:103000091-103000113 GACGACACCAGACCAGAGAAGGG + Intronic
1122807451 14:104267158-104267180 GCAGCCACCAGCCCCCAGCAGGG - Intergenic
1125355968 15:38817822-38817844 GCCGACACCTGGCCAGCGCAGGG - Intergenic
1127974581 15:63987764-63987786 CCTGACACCAGCCCAGAGTTAGG - Intronic
1130056445 15:80530415-80530437 GCTGAGATCAGCACAGAACACGG - Intronic
1132392006 15:101445998-101446020 GTTGACATCAGCCCAGACCCAGG - Intronic
1132785683 16:1656080-1656102 GCTGCCCCCAGCCCAGATCCTGG + Exonic
1133101319 16:3481834-3481856 GCTGACCCCAGCCCAGCACGTGG + Intronic
1133207433 16:4241879-4241901 GAAGACACCAGCCAAGAGCCAGG + Intronic
1133235790 16:4386815-4386837 GCTGAGAGCCGCCCAGAGGAGGG - Intronic
1133398692 16:5468975-5468997 GCAGACACCTACCAAGAGCAAGG - Intergenic
1133607782 16:7405261-7405283 GCTGATGCCAGCCCAGAGGCAGG + Intronic
1133934422 16:10257044-10257066 GCTGAAAACAGCCCTGAGCAGGG + Intergenic
1133972577 16:10578507-10578529 GCTGGCACCACCCCAGATTAGGG - Intronic
1133976168 16:10601239-10601261 CCTGACACCCGCCCAGAGGCTGG + Intergenic
1134066158 16:11229752-11229774 ACTGCCAACAGCCCAGAGCCAGG + Intergenic
1134342595 16:13358786-13358808 GCTGAAAACAGCCAAGAGAAAGG - Intergenic
1134691715 16:16195070-16195092 GTAAACACCAGCCCACAGCAGGG + Intronic
1134763730 16:16737321-16737343 CCTGTCACAAGCCCAGTGCAAGG - Intergenic
1134982324 16:18621836-18621858 CCTGTCACAAGCCCAGTGCAAGG + Intergenic
1136670212 16:31849784-31849806 GCTGACAGTGGCCCAGGGCACGG + Intergenic
1138537724 16:57668605-57668627 CCTGAGACCAGTCCTGAGCAAGG - Intronic
1138561980 16:57806537-57806559 GCTGACCCCAGCTCAGGGCCTGG + Intronic
1138810088 16:60139476-60139498 GCTGACACAAGCACACAGCATGG - Intergenic
1139448721 16:67014226-67014248 CCTGGCGCCAGCCCAGAGCCGGG + Intergenic
1139960217 16:70713327-70713349 GCAGCCACCAGCATAGAGCAGGG + Intronic
1139994641 16:70968338-70968360 GCTGACACCACCCCAGCAGAGGG - Intronic
1141529165 16:84634309-84634331 GCTGACCTCAGCCCGAAGCAGGG + Intergenic
1142311709 16:89317927-89317949 CCTGAAACCAGCGCAGAGCCAGG + Intronic
1142499076 17:322297-322319 GCTGGCACCCACCCAGGGCAGGG - Intronic
1142757035 17:2022728-2022750 GCTGAGCCCAGCCCAGTGAAGGG + Intronic
1143473568 17:7190877-7190899 GGTTGCACCAGCCCAGAGGAAGG + Intronic
1144276310 17:13671886-13671908 GCTCACTCCAGCCCTGACCAAGG - Intergenic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1145912233 17:28549454-28549476 GCTGACTCAAGCCCAGAGCCTGG + Intronic
1147519924 17:41160781-41160803 GATGACATCAGCCCTGAGCAGGG - Intergenic
1147978004 17:44258969-44258991 GACGAGACCAGGCCAGAGCAGGG + Intronic
1148610514 17:48961633-48961655 CCTGACCCCAGAGCAGAGCAAGG - Intronic
1150500924 17:65650222-65650244 CCTGACATCACCACAGAGCAGGG - Intronic
1151479682 17:74362599-74362621 GGTGACCCCTGCCCAGAGCGGGG + Intergenic
1151671863 17:75575303-75575325 CCTGACACCGGCCCAGGCCAGGG - Intergenic
1151966469 17:77434177-77434199 GCAGACAGCAGGCCAAAGCAAGG - Intronic
1151985994 17:77544161-77544183 GCTGAGGCCAGCCGAGACCATGG - Intergenic
1152073247 17:78144456-78144478 GCTGCCAGCAGCCCAGGGCCTGG + Intergenic
1152223608 17:79082520-79082542 GGTCACACCAGCACAGAGGAAGG + Intronic
1152937513 17:83148963-83148985 GCTGACTCCAGCTCCTAGCATGG + Intergenic
1155169755 18:23258759-23258781 TCACACACCAGCCCAGAGAAAGG + Exonic
1156270197 18:35523635-35523657 GTTGACACCAGCCCAGCTCCAGG + Intergenic
1156270489 18:35525984-35526006 GTTGACACCAGCCCAGCTCCAGG - Intergenic
1156272175 18:35545694-35545716 GCTGAGACCACCCCACAGGAAGG - Intergenic
1157131576 18:45012409-45012431 ACTCACACCACCCCAGGGCAAGG - Intronic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1160687726 19:444503-444525 GGGGACACCAGCCTAGTGCACGG + Intronic
1161119333 19:2516845-2516867 GCTGGCAGCAGCCCGGGGCAGGG - Intronic
1161142281 19:2654810-2654832 GATGGCCCCAGCCCAGAGAATGG - Intronic
1161229825 19:3168343-3168365 ACTGAGACAATCCCAGAGCAAGG - Intergenic
1161684448 19:5696009-5696031 GCTGTCCCCTTCCCAGAGCAGGG - Intronic
1162355812 19:10184143-10184165 TCTGACAACAGCCCATAACAAGG + Intronic
1162725954 19:12689815-12689837 GTTGTCACCAGCCCAGAGCTGGG + Exonic
1166647640 19:44543962-44543984 GCTGAGTCCTGCCCAGATCATGG + Intergenic
925306759 2:2852107-2852129 GCTGAAGCAAGCTCAGAGCACGG + Intergenic
925769389 2:7267398-7267420 CCAGACAGCAGCCCCGAGCAAGG - Intergenic
926632349 2:15147982-15148004 TCTGTCCCCAGCACAGAGCAAGG - Intergenic
927849028 2:26487356-26487378 GCTGAATCCAGCCCTGAGCCTGG - Intronic
928110807 2:28507222-28507244 GCTGAGGCCAACCCAGAGCCAGG - Intronic
929554596 2:42917804-42917826 GCTGACACCAACCATGAGCAAGG - Intergenic
930146848 2:48016335-48016357 GCTTTCACAAGGCCAGAGCAAGG + Intergenic
932498408 2:72159264-72159286 GTTAAAACGAGCCCAGAGCAAGG + Intergenic
934154372 2:89182192-89182214 GCAGACACCTGCCCTGAGCCAGG + Intergenic
934212859 2:89999748-89999770 GCAGACACCTGCCCTGAGCCAGG - Intergenic
934713547 2:96530476-96530498 GCTGACCCCAGGCCATTGCAAGG + Intergenic
935242566 2:101191083-101191105 GCTGCCACATGCTCAGAGCACGG + Intronic
935855981 2:107274567-107274589 GGTGACAGCAGCCCAGAGACAGG - Intergenic
937077812 2:119119706-119119728 CCTCACACCAGCCCAGAGTGAGG - Intergenic
937276648 2:120688889-120688911 TCTGAAACCAGCAGAGAGCAGGG + Intergenic
937895715 2:126975471-126975493 GGGGACACCAGCCAAGAGAACGG - Intergenic
937956995 2:127427170-127427192 GCTGACAGCGGCCCACTGCATGG + Exonic
938082087 2:128375581-128375603 CCTGACACCAGCCCAGGTCCTGG - Intergenic
940082491 2:149819804-149819826 GGTGACAACAGAACAGAGCAGGG + Intergenic
942144966 2:173017887-173017909 CCTGAGCCCAGCCCTGAGCAGGG + Intronic
942901174 2:181121047-181121069 GCTAACACAAGCTCAGAGGAGGG + Intergenic
943607781 2:189996892-189996914 CCCAACACCAGCCCAGAGCCTGG - Intronic
946409224 2:219508159-219508181 GATGACCCCAGCCCAGAGTGGGG - Intergenic
947867278 2:233407879-233407901 ACAGACATCAGCCCAGAGGATGG + Intronic
948665155 2:239529960-239529982 CCTGTCACCAGCTCAGAGCCGGG - Intergenic
1168972869 20:1942744-1942766 GCTGAACCCAGCCCAGGGCCTGG + Intergenic
1169142536 20:3234424-3234446 GCTCGCACCAGCCCAGGGCTGGG - Intronic
1170245694 20:14219824-14219846 GCCAATACCAGCCCAGAGCCAGG - Intronic
1170438046 20:16350470-16350492 GCTGAACTCAGCCCAGAGCCAGG + Intronic
1170611177 20:17914981-17915003 CCTGACCCCAACCCAGGGCATGG + Intergenic
1171409337 20:24935585-24935607 GCTCCCACCAGCCCAGGGAAGGG - Intergenic
1172639633 20:36432922-36432944 TCTGAGCCCAGCCCTGAGCAGGG + Intronic
1174078172 20:47952652-47952674 GCTGTCCCCAGCCCTGTGCATGG + Intergenic
1174377922 20:50138754-50138776 GCTGCCACCACCCCAAAGCTGGG - Intronic
1174555019 20:51388311-51388333 GCTGACTTCAGCCCTGAGCCTGG - Exonic
1175215663 20:57390677-57390699 CCTGACACCAGCCCAGAACGGGG + Intergenic
1176152083 20:63596637-63596659 TCTGACTCCAGCACAAAGCAGGG + Intronic
1176282220 20:64320110-64320132 TCTGATGCCAGCACAGAGCATGG + Intergenic
1176705778 21:10119383-10119405 GCTGAGACCAGCCCCGGCCAGGG - Intergenic
1176876072 21:14130502-14130524 TCTGTCAGCAGCCCATAGCATGG - Intronic
1177080774 21:16635846-16635868 GCTGACAGTAGACTAGAGCATGG + Intergenic
1177162736 21:17565653-17565675 GATGATTCCAGCACAGAGCAAGG + Exonic
1178491962 21:33058083-33058105 GCCGACTGCAGCCCAGAGAAAGG - Intergenic
1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG + Intronic
1178641920 21:34351790-34351812 GCTGCCAACAGCCCAGAGAAAGG - Intergenic
1178815122 21:35922328-35922350 GCTACCAGCAGCCCAGAACACGG + Intronic
1179631581 21:42682007-42682029 TCTGACACCAGCGAAGAGCGCGG + Intronic
1180103154 21:45599339-45599361 GCTGCCAGAAGCCCACAGCAGGG + Intergenic
1180119481 21:45737209-45737231 GCTGAGAGGAGCCCACAGCAGGG + Intronic
1183295445 22:37026674-37026696 ATAGAGACCAGCCCAGAGCAAGG - Intronic
1183317381 22:37144142-37144164 GCAGACGCCAGGACAGAGCAGGG + Exonic
1183597787 22:38822734-38822756 CCTGACACCAGCCCAGGTCCTGG - Exonic
1183828823 22:40407415-40407437 GCTGACTCCAGACTATAGCATGG + Exonic
1183935251 22:41258201-41258223 GCTGCCGCCAGCACAGGGCAGGG + Intronic
1184088795 22:42281852-42281874 CCTGGCACCTGCCCAGAGCTGGG - Intronic
1184091805 22:42296747-42296769 GCTGATGCCAGCCCCAAGCAGGG + Intronic
1184413663 22:44339894-44339916 GCTGCCCCCAGCACATAGCAGGG - Intergenic
1184461484 22:44640372-44640394 GCTGACCCCATCCCAGTGCTCGG - Intergenic
1184864505 22:47194822-47194844 CCTGATCCCAGCCCAGAGCTGGG + Intergenic
1185307380 22:50127549-50127571 GCTGACACCAGCAGAGAGTCGGG - Intronic
949749389 3:7333327-7333349 GCCAGCACCAGCCCAGAGCCCGG + Intronic
950146043 3:10650694-10650716 TCTGACAGCTGCACAGAGCAGGG - Intronic
950658557 3:14452514-14452536 CCAGCCACCAGCCCAGAGCCCGG + Intronic
952139725 3:30465564-30465586 CCTGAAACCAGCACAGAGCTCGG + Intergenic
953030241 3:39175189-39175211 TCAGTCCCCAGCCCAGAGCAGGG - Intergenic
953202612 3:40790921-40790943 GCTGACTCCAGCCACCAGCAAGG + Intergenic
953702834 3:45210157-45210179 GCTGGAACCACCCCAGAGAAAGG + Intergenic
958151498 3:89699393-89699415 GCAGACACAAGCACAGAGCCGGG + Intergenic
959266201 3:104142091-104142113 GCTGACACCAGACCAAATTAAGG + Intergenic
960811738 3:121632952-121632974 GCTAACACCAGAACAGTGCAAGG + Intronic
960851182 3:122056285-122056307 GCTGCCACCACCCAAGAGAAGGG - Intronic
961253027 3:125522517-125522539 ACTGGTACCAGCCCACAGCATGG + Intergenic
962031578 3:131606557-131606579 GTGGACACTAGACCAGAGCAGGG - Intronic
964433603 3:156630095-156630117 GCTGACCCCAGTCCACAGCATGG + Intergenic
964843582 3:161022283-161022305 GTTGACAACAGCACAGAGAATGG - Intronic
966918608 3:184598134-184598156 CCCGACCCCAGCCCAGAGGACGG - Intronic
968520512 4:1032837-1032859 ACAGAGAGCAGCCCAGAGCATGG + Intergenic
968626139 4:1627544-1627566 GCTGACCCCTCCCCACAGCATGG + Intronic
969123195 4:4924685-4924707 GCTGACTCCAGCCCAGCTCCAGG + Intergenic
969327399 4:6451932-6451954 AGTGACACCACCCCAGAGCCAGG + Intronic
970406030 4:15765354-15765376 GCTGATGCCAACCCAGTGCAAGG + Intergenic
970826040 4:20276723-20276745 GCTGAGAACAGCACAGAGAAAGG + Intronic
971812355 4:31442351-31442373 AATGACATCAGCCCAGAGTAAGG - Intergenic
973712747 4:53645376-53645398 GCTGAGAACAGCCCACAGCAGGG - Intronic
974197915 4:58600595-58600617 GCTGACACCAGCCACAAGCTTGG + Intergenic
975475504 4:74818780-74818802 GCTGACACAGGCCCAAAGCTAGG - Intergenic
977401158 4:96534308-96534330 GCTGAGACCTGCCAAGAGCTGGG + Intergenic
980354605 4:131725163-131725185 GCTGACACCAGTCCTGGCCAGGG + Intergenic
981078896 4:140618636-140618658 GATGACACCAGTGCAGAGGAAGG - Intergenic
981488416 4:145313429-145313451 GGTTACACTAGCCCAGAGGAAGG + Intergenic
982721910 4:158868488-158868510 GCTAACAGGAGGCCAGAGCAGGG + Exonic
984169476 4:176343462-176343484 GCTGAGAGCAGCTCAGTGCAGGG - Intergenic
985010896 4:185580966-185580988 GCTCAGATCAGCCCAGAGCAGGG - Intergenic
985530555 5:431435-431457 TCTGAATCCAGCTCAGAGCAGGG - Intronic
985537648 5:473794-473816 TCTGCCTCCAGCTCAGAGCAGGG - Intronic
985675783 5:1230623-1230645 GGTGACACAAACCCAGAGCAAGG + Intronic
985693278 5:1325358-1325380 GCAGCCACCAGCTCAGGGCAGGG + Intronic
985833906 5:2256933-2256955 GCAGGCACCAGCCAGGAGCAGGG - Intergenic
985927273 5:3028043-3028065 ACGGCCACGAGCCCAGAGCAAGG - Intergenic
986396974 5:7340880-7340902 TCTGGGACCAGCACAGAGCATGG + Intergenic
986617800 5:9638225-9638247 CCTGATATCAGCCCAGAGCTTGG - Intronic
986710675 5:10486085-10486107 GGTGTGAGCAGCCCAGAGCAGGG - Intergenic
986715821 5:10522929-10522951 GCTGACATCAGGCCTGAGAAGGG + Intergenic
987015013 5:13809117-13809139 TCTGATACCACCCCAGAGTATGG - Exonic
987516630 5:18918474-18918496 CTTAACAGCAGCCCAGAGCAAGG + Intergenic
989525945 5:42454095-42454117 GCCAGCACCAGCCCAGAGCCTGG - Intronic
989590225 5:43105775-43105797 GCTGAAACCAGCCAAGTCCATGG - Intronic
990989983 5:61675137-61675159 TAGGCCACCAGCCCAGAGCAGGG - Intronic
992190459 5:74286402-74286424 GATGACACCAACCCACAGCGTGG - Intergenic
992696873 5:79297970-79297992 TCTGACTGCAGCCCAGAGCCAGG - Intronic
1001479450 5:172077850-172077872 CCTTTAACCAGCCCAGAGCAAGG - Intronic
1001488004 5:172133514-172133536 GATGACACCAGCCCTGAGTCAGG - Intronic
1002424153 5:179165901-179165923 GCTGACCCTAGCTCAGAGCACGG + Intronic
1002565709 5:180112165-180112187 GGTGACACCAGCCCAGAGCCAGG - Intronic
1003253775 6:4456824-4456846 GTTGACTCCACACCAGAGCAGGG - Intergenic
1003395078 6:5746183-5746205 GCTGAGACCAACCCAAAGCCAGG + Intronic
1004722978 6:18284614-18284636 GCTGACCCCTGCCAAGAGAATGG - Intergenic
1006670874 6:35728971-35728993 GATGACAGCAGCCCAGAGCAGGG + Intergenic
1006905395 6:37529881-37529903 CCTGACACTAGACCAGAGCTTGG + Intergenic
1007594904 6:43045440-43045462 GCTGACCCCAGCCCATCCCAAGG - Intronic
1009616232 6:66010516-66010538 GATTACAGCAGCCCAGAGCAGGG + Intergenic
1010045354 6:71436716-71436738 CCTGGTACCAGCCCAGAGCCAGG + Intergenic
1013456579 6:110335018-110335040 GCTGCCACCAGGGCAGAACAAGG + Intronic
1013531337 6:111021546-111021568 GCTGAGCCCAGCTCAGAGCCAGG - Intronic
1013591968 6:111626502-111626524 ACTAACACCAGCCCAGAAAAAGG + Intergenic
1015366136 6:132400671-132400693 GCTGACATCAGCCCCGCGCCTGG + Intronic
1015778922 6:136843349-136843371 GTTTACATCAGCCTAGAGCAGGG + Intronic
1015963856 6:138677952-138677974 GGTGGCACCAGCCTAGAGAATGG - Intronic
1016680520 6:146823924-146823946 CCTTATACCAGCCCAGAGAAGGG - Intergenic
1016918350 6:149265912-149265934 GCTGACAAAAGCCGAGAGCAGGG - Intronic
1018170975 6:161142798-161142820 GCAGACACCACCCGAGTGCACGG + Intronic
1018435780 6:163757685-163757707 GCTGGCAACAGCCATGAGCAAGG - Intergenic
1018791840 6:167154629-167154651 GCTGACACCACCCCAGATATAGG + Intronic
1018869413 6:167769918-167769940 GCTGAGAGCCGCCCAGAGCTCGG + Intergenic
1019638793 7:2091278-2091300 GCTGACCGGGGCCCAGAGCAGGG - Intronic
1020473063 7:8561424-8561446 ACTGAAAACAGCCCAGAGGAGGG - Intronic
1023599776 7:41870312-41870334 GATGACAGCAGACCAGAGCCAGG + Intergenic
1023677360 7:42644242-42644264 GCTGACATTAGCCCAGTGGATGG + Intergenic
1023998001 7:45173890-45173912 CCTGACACCAGGCCTGAGCTGGG + Intronic
1024001244 7:45190663-45190685 GCTGAAGCCAGCCCAGTGCACGG - Intergenic
1024545557 7:50514170-50514192 CCTGGTACCAGCCCAGAGCTGGG + Intronic
1029109263 7:98204056-98204078 GCCGCCACCGGCCCGGAGCACGG + Exonic
1029280114 7:99430034-99430056 GCTGACAAGTGCCCAGGGCAGGG - Intronic
1030060147 7:105615347-105615369 ACTGCCTCCAGCCCAGAGCAGGG - Intronic
1030955401 7:115845554-115845576 GCTGGGATCAGGCCAGAGCAGGG - Intergenic
1031076605 7:117219452-117219474 GCAGACACCAGCCCAAACCAGGG - Intronic
1031923512 7:127618210-127618232 ACTGACACCAGCCCTGAGGCAGG + Intergenic
1032063823 7:128748772-128748794 GCTGACACCAGAAGAGAGCAAGG + Exonic
1033365957 7:140672924-140672946 GCGGGCACCAGCCCAGGGCGCGG - Intronic
1033550047 7:142438746-142438768 GCTTTCCCCAGCCCAGAACACGG - Intergenic
1034534667 7:151719446-151719468 GCTGGGAGCAGCCCAGGGCAGGG - Intronic
1034637391 7:152578038-152578060 GGTGTCAGCAGCCCAGAACAGGG + Intergenic
1035055058 7:156029572-156029594 ACAGACAGCAGCACAGAGCAGGG - Intergenic
1035055064 7:156029633-156029655 ACAGACAGCAGCACAGAGCAGGG - Intergenic
1035055074 7:156029800-156029822 ACAGACAGCAGCACAGAGCAGGG - Intergenic
1035158722 7:156935421-156935443 TCTCACACCAGCTCAGTGCAGGG - Intergenic
1035270258 7:157715563-157715585 GCTTACACCAGCGCAGTGCCTGG - Intronic
1035397242 7:158543198-158543220 GCAGACAGCACCCCCGAGCACGG + Intronic
1035782169 8:2237070-2237092 ACAAACACCAGCCCAGAGCAGGG + Intergenic
1035809950 8:2482508-2482530 ACAAACACCAGCCCAGAGCAGGG - Intergenic
1036807200 8:11843593-11843615 CCTGACTCCAGCCCAAACCAAGG + Exonic
1038062710 8:23930276-23930298 CCTGACCCCAGCCCAGGGCCAGG + Intergenic
1038642167 8:29337448-29337470 GCAGACCCCAGCCCCGACCAGGG + Intronic
1038704407 8:29880443-29880465 CCTTACACCAGCCTAGAGCCAGG + Intergenic
1038884272 8:31646372-31646394 GCTGAATCAAGCCCAGTGCAAGG + Intronic
1039425102 8:37479141-37479163 TCTGTCACCAGGCCAGAGCAGGG - Intergenic
1042180389 8:66081649-66081671 CCTGACTCCAGCTCAGAGGAAGG + Intronic
1045381134 8:101627666-101627688 GCTGACACAGGCCAAGAGCTGGG + Intronic
1045409944 8:101906789-101906811 GTGGACATCACCCCAGAGCAAGG + Intronic
1048759544 8:137778531-137778553 GCTGACACCACATCTGAGCAAGG + Intergenic
1049262620 8:141647760-141647782 TCTGAGACCAGAACAGAGCAGGG - Intergenic
1049869716 8:144965268-144965290 CCTGATACCAGACCAGAGCCTGG - Intergenic
1051936545 9:22448219-22448241 GCTGAAAACAGTCCAGAGCAGGG - Intronic
1052824281 9:33163917-33163939 CCTCACATTAGCCCAGAGCAGGG + Intronic
1053103578 9:35391593-35391615 TGTAACACAAGCCCAGAGCAGGG + Intronic
1053643059 9:40106500-40106522 GCTGAGACCAGCCCTGGCCAGGG - Intergenic
1053763088 9:41358988-41359010 GCTGAGACCAGCCCTGGCCAGGG + Intergenic
1054323908 9:63703727-63703749 GCTGAGACCAGCCCTGGCCAGGG - Intergenic
1054541698 9:66270103-66270125 GCTGAGACCAGCCCTGGCCAGGG + Intergenic
1055934462 9:81591970-81591992 GCAGACACCACACCAGGGCAGGG + Intronic
1056539903 9:87562029-87562051 CCTCACTCCACCCCAGAGCATGG + Intronic
1057303790 9:93901159-93901181 GCCGACGCCAGCACAGAACAAGG - Intergenic
1059925521 9:119205505-119205527 GCAGACACCTGCACTGAGCATGG + Intronic
1060562620 9:124559009-124559031 GCTGGTACCAGGCCAAAGCAAGG + Intronic
1061299837 9:129698078-129698100 GCTGACAGCAGCCAGGACCAGGG - Intronic
1061572202 9:131484790-131484812 GGTAACACCAGCCCTGAGCTGGG + Exonic
1062039674 9:134398503-134398525 GCAGACACCTTCCCAGAGCCTGG - Intronic
1062413220 9:136434967-136434989 GCTGCCCCCAGCCCCAAGCAAGG + Intronic
1202790812 9_KI270719v1_random:89472-89494 GCTGAGACCAGCCCCGGCCAGGG - Intergenic
1187428854 X:19203416-19203438 GGTGCTGCCAGCCCAGAGCAGGG - Intergenic
1189251236 X:39601900-39601922 GGCCACACCAGCCCAGCGCAGGG + Intergenic
1189724509 X:43954861-43954883 GCTGGCCCCAGGCCAGGGCATGG - Intronic
1192498039 X:71629330-71629352 GCAAACACCAGCCAAGAGAATGG + Intergenic
1193748214 X:85309813-85309835 TCTGACACCATCCCAGTGAATGG - Intronic
1194328856 X:92556627-92556649 TGTGAAAGCAGCCCAGAGCAGGG - Intronic
1195821485 X:108949938-108949960 TCTGACACCATCCCAATGCAGGG + Intergenic
1200091842 X:153639697-153639719 GCTGAGACAAGCCAACAGCAGGG + Intergenic
1200637562 Y:5675829-5675851 TGTGAAAGCAGCCCAGAGCAGGG - Intronic