ID: 1178586484

View in Genome Browser
Species Human (GRCh38)
Location 21:33875187-33875209
Sequence CTGCTACGTGATTGCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178586479_1178586484 7 Left 1178586479 21:33875157-33875179 CCACTGGAGCCATCAAGGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 166
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1178586474_1178586484 20 Left 1178586474 21:33875144-33875166 CCCGCAATGCCACCCACTGGAGC 0: 1
1: 0
2: 1
3: 11
4: 200
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1178586481_1178586484 -2 Left 1178586481 21:33875166-33875188 CCATCAAGGAGTGGCCGTCATCT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1178586477_1178586484 11 Left 1178586477 21:33875153-33875175 CCACCCACTGGAGCCATCAAGGA 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1178586478_1178586484 8 Left 1178586478 21:33875156-33875178 CCCACTGGAGCCATCAAGGAGTG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81
1178586475_1178586484 19 Left 1178586475 21:33875145-33875167 CCGCAATGCCACCCACTGGAGCC 0: 1
1: 0
2: 0
3: 15
4: 224
Right 1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178586484 Original CRISPR CTGCTACGTGATTGCCATGT GGG Intronic
901175537 1:7296089-7296111 CTGTTTGGTGAATGCCATGTGGG + Intronic
905239985 1:36575313-36575335 CTGCTATGTGTTAGCCCTGTGGG + Intergenic
907571833 1:55491041-55491063 ATGCTATGTTACTGCCATGTTGG - Intergenic
909002031 1:70229510-70229532 CTGCTACTTGATTTGCATTTTGG + Intronic
1064928739 10:20599726-20599748 GTGATAGGTGATTGCCATGGTGG + Intergenic
1066616112 10:37296505-37296527 CTCCTAAGTGATTTCCATCTTGG - Intronic
1068926470 10:62544715-62544737 CTGCAACCTAATTGCCATCTTGG - Intronic
1069754092 10:70762599-70762621 CTGCTGCGTCACTGCCAGGTGGG + Intergenic
1072415810 10:95245960-95245982 CTGCAAAGGGATTGGCATGTTGG - Intronic
1073852130 10:107633562-107633584 TTGCCACCTGATTGCCAAGTAGG + Intergenic
1073922705 10:108478061-108478083 CTTCTACTTGATTGTAATGTAGG - Intergenic
1089133975 11:116234770-116234792 CTGCTTGGTGAGTGCCAAGTAGG - Intergenic
1097068789 12:56339772-56339794 CTGCTCCCTGATAGCCCTGTGGG + Exonic
1098644514 12:72881547-72881569 GTGCTCCTTGATTCCCATGTTGG - Intergenic
1100302143 12:93317484-93317506 CTGCTTCCTCATTGCCATTTGGG - Intergenic
1105473457 13:20712003-20712025 CTGCGACCTGTTTCCCATGTGGG + Intronic
1108097811 13:46923329-46923351 CTGCTTTGTTACTGCCATGTGGG + Intergenic
1108798842 13:54067668-54067690 CTGCTTCGTGAGTCCCATGAAGG + Intergenic
1113800820 13:113085521-113085543 CAGCTATGAGTTTGCCATGTGGG + Intronic
1114724841 14:24924998-24925020 CTGAAACCTGATAGCCATGTGGG - Intronic
1117657813 14:57974252-57974274 CTGCACCAAGATTGCCATGTTGG - Intronic
1124585536 15:31002607-31002629 CTGCAAGGTGACTGCCATCTGGG + Exonic
1130669441 15:85898662-85898684 CTGCTACGTGATACGCATTTGGG + Intergenic
1132080856 15:98864275-98864297 CTCCAACTTGTTTGCCATGTTGG - Intronic
1133884508 16:9813449-9813471 CTGCTAGGTGATTGGGATGATGG - Intronic
1136134217 16:28244955-28244977 CTGATATCTAATTGCCATGTAGG - Intergenic
1148980171 17:51566796-51566818 CTGCTACCTGATCCCCATGCGGG - Intergenic
1152182069 17:78828682-78828704 CTGCTAAGTGCTCGCCCTGTAGG - Intronic
1153151987 18:2106137-2106159 CTGCTAGTTGGTTCCCATGTGGG - Intergenic
1158480268 18:57815677-57815699 CTGCTAAGTGGTTGCCATCTTGG + Intergenic
1164713766 19:30376961-30376983 CTGCTACTTGGCTGCCCTGTGGG + Intronic
927517987 2:23683025-23683047 CTGCTCCCTGATTGCCAGGCAGG - Intronic
928379515 2:30805543-30805565 CTGCTAAGTGCTTTCCATATAGG + Intronic
934058359 2:88271236-88271258 CTGGAACCTGATTGCCAGGTGGG + Intergenic
944316371 2:198289869-198289891 TTGATACATCATTGCCATGTAGG - Intronic
1175257014 20:57653611-57653633 ATGCTACCTGAGTGCCACGTGGG - Intronic
1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG + Intronic
950282914 3:11722093-11722115 CTGCTAAATGATTTCCATTTTGG + Intergenic
959589215 3:108058394-108058416 CTCCTTCGTCATTGCCATATTGG - Exonic
960036259 3:113105624-113105646 CTCCTGGGTGATTCCCATGTAGG - Intergenic
960051316 3:113241737-113241759 CTGCTGCATGCTTGCCATATGGG - Intronic
960140697 3:114149388-114149410 CTGCTACCTGATTTCTATGATGG + Intronic
961010023 3:123429526-123429548 ATGCTGCGTGATTGGCAGGTGGG - Intronic
965303852 3:167039179-167039201 CTATTATGTGATTGCAATGTAGG + Intergenic
971655013 4:29332957-29332979 CTGCAACCTGAATGTCATGTAGG - Intergenic
973668442 4:53188556-53188578 CTGCTCCTTCCTTGCCATGTAGG - Intronic
977008468 4:91603835-91603857 CTGCTTCCTGATTTGCATGTTGG + Intergenic
990635900 5:57725879-57725901 CTGCTATGTGTTTCACATGTGGG - Intergenic
992948414 5:81832540-81832562 CTGCCACTTGGATGCCATGTGGG - Intergenic
995127757 5:108595848-108595870 CATCTAAGTGATTGCCATCTTGG + Intergenic
995566649 5:113437923-113437945 CTGCTCCTTCAGTGCCATGTGGG + Intronic
999553582 5:152717333-152717355 CTGCTACTTGTTAGACATGTAGG - Intergenic
999892467 5:155993738-155993760 CCTCTATGTGGTTGCCATGTGGG + Intronic
1000960389 5:167594399-167594421 CAGCTACTACATTGCCATGTGGG - Intronic
1001492688 5:172166565-172166587 GTCCTACGTGTTTTCCATGTAGG - Intronic
1002356422 5:178632947-178632969 CTACTACGTGACTGTCAGGTAGG - Intergenic
1011953181 6:92993350-92993372 ATACTAAGTAATTGCCATGTGGG - Intergenic
1015195835 6:130523989-130524011 CTGCTACGTGAGGGCCCTGCCGG + Intergenic
1016130010 6:140456614-140456636 CTACTATGTTATTGCCAGGTTGG + Intergenic
1017694630 6:157002138-157002160 CTGTTTCCTGATTGCCAAGTCGG + Intronic
1017992456 6:159503418-159503440 TTGCTAAGTGATTGTCTTGTTGG + Intergenic
1018022865 6:159778347-159778369 CTTCTAGGTGTTGGCCATGTGGG + Intronic
1019624811 7:2010770-2010792 CTGCTACCTGACCGCCAGGTGGG - Intronic
1020775306 7:12446052-12446074 CTGCTACTTTATAGTCATGTGGG + Intergenic
1021501657 7:21338554-21338576 ATGCTAGGTTATTGCCAGGTTGG + Intergenic
1021889702 7:25175507-25175529 CTGCCAAGTGAGTGCCATGATGG + Intronic
1022180476 7:27914119-27914141 CTGCTATCTGTTTGCTATGTGGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1027642420 7:80753595-80753617 ATGCTATGTGAGTGCCATGGAGG - Intronic
1030778326 7:113564677-113564699 CTGCTAAGAGATTGCCAAGATGG - Intergenic
1038226525 8:25663274-25663296 CTGTGATGTGATTGGCATGTGGG + Intergenic
1043307565 8:78816043-78816065 TTGCTTTGTGATTGCCATGAGGG + Intergenic
1047003664 8:120597605-120597627 TTGCTAATTGATTGCCATTTTGG + Intronic
1048299947 8:133244339-133244361 CTCCCAGGTGAGTGCCATGTTGG - Exonic
1055688891 9:78808680-78808702 CTGCTATGTGCTGGACATGTTGG + Intergenic
1056816256 9:89803408-89803430 CTGCTGCGTGTTTGACATGATGG + Intergenic
1058703918 9:107623424-107623446 ATGCTACCAGATTGCCAAGTGGG - Intergenic
1058713993 9:107707023-107707045 TTGCTCAGTGATTGCCATGGGGG + Intergenic
1061818230 9:133208569-133208591 CTGGTACGTGAAGGCCATGGTGG - Exonic
1062242226 9:135546789-135546811 CTGGTACGTGAAGGCCATGGTGG + Exonic
1189029043 X:37430825-37430847 CTGCTACTTGATTGCAGTGATGG - Intronic
1189688724 X:43593119-43593141 CTTCTACTTCATTGGCATGTGGG + Intergenic
1193091916 X:77502686-77502708 CTGCTTTGTTATTGGCATGTGGG + Intergenic