ID: 1178587599

View in Genome Browser
Species Human (GRCh38)
Location 21:33883173-33883195
Sequence CTGGCTGGTGTCGCTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178587599_1178587606 25 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587606 21:33883221-33883243 TACCCGCAAAATCGTGGGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 16
1178587599_1178587602 19 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587602 21:33883215-33883237 AAAACATACCCGCAAAATCGTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1178587599_1178587604 23 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587604 21:33883219-33883241 CATACCCGCAAAATCGTGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1178587599_1178587603 20 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587603 21:33883216-33883238 AAACATACCCGCAAAATCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1178587599_1178587605 24 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587605 21:33883220-33883242 ATACCCGCAAAATCGTGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1178587599_1178587607 26 Left 1178587599 21:33883173-33883195 CCAGGAAAAGCGACACCAGCCAG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1178587607 21:33883222-33883244 ACCCGCAAAATCGTGGGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178587599 Original CRISPR CTGGCTGGTGTCGCTTTTCC TGG (reversed) Intronic
900899874 1:5509149-5509171 CTGGCTGCTGTTGCTGTCCCAGG - Intergenic
902875957 1:19341012-19341034 CTGGGTGCTGTTGCTTCTCCTGG - Intronic
903322310 1:22550485-22550507 CTGCGTGGTGTCTCTTCTCCAGG - Intergenic
903847810 1:26288949-26288971 CTTACTGGGGTCCCTTTTCCAGG + Intronic
906114220 1:43345312-43345334 CTCCCTGGTGAGGCTTTTCCTGG - Intronic
906928445 1:50144171-50144193 CTGGCTGGTGTGAATGTTCCAGG - Intronic
907723405 1:56995598-56995620 CTGGCTGATGTTGCTGTTTCAGG - Exonic
907749440 1:57247914-57247936 TTGGAGGGTGTCTCTTTTCCAGG - Intronic
911523666 1:98959248-98959270 CTTGCTGGGGCCACTTTTCCCGG + Intronic
914718110 1:150268096-150268118 CTGGCTGGTCTCCCTGCTCCTGG - Exonic
915435165 1:155899720-155899742 CTGGCTGTTCTCACTTATCCCGG + Intronic
915631419 1:157155970-157155992 CAGGCTGGGGTCTCTTTTTCAGG + Intergenic
916742858 1:167661578-167661600 GTGGCTGCTGTGGCTTTTGCAGG - Intronic
920702915 1:208231308-208231330 CTGGCTGTTTACCCTTTTCCCGG - Intronic
921269298 1:213452907-213452929 CTGGCTGGTTCCGCTTTGCTTGG + Intergenic
921282556 1:213581608-213581630 CTGGCTGGAGCCACCTTTCCTGG - Intergenic
923135828 1:231117864-231117886 CTTGCTGGTCTTGCCTTTCCTGG + Intergenic
1063916581 10:10889003-10889025 CTGGTTGGTGTCCCTTCTCTGGG - Intergenic
1069801478 10:71084512-71084534 CTGGCTGGTGGCTTTTTCCCAGG - Intergenic
1070001311 10:72379871-72379893 CTAGCTGGGGTCCCCTTTCCTGG + Intronic
1071789375 10:88938242-88938264 ATGGCCTGTGTCTCTTTTCCAGG - Exonic
1074385963 10:113016923-113016945 CTTGCTGGTGTCTCTCTGCCCGG + Intronic
1076202452 10:128569323-128569345 ATGGCTGCTGTCGTTTTTGCTGG + Intergenic
1078062372 11:8056286-8056308 CTGGCTGGGGTCTCCTGTCCTGG + Intronic
1078547260 11:12255494-12255516 CTGGCTGGTTTTGCTTCTCCTGG + Intronic
1079205931 11:18414402-18414424 CTGTCTAGTGTCCCTTTTTCTGG - Intronic
1080515750 11:33017936-33017958 TTGCCTGGTATCACTTTTCCAGG + Intronic
1081711031 11:45215503-45215525 CTGGCTGCTCTCTCTCTTCCTGG + Intronic
1082903621 11:58283264-58283286 CTGGCTTCAGTCGCCTTTCCAGG + Intergenic
1083089932 11:60189413-60189435 CTGCATGGTATCTCTTTTCCAGG + Intergenic
1084196481 11:67525687-67525709 CTGTCTGGTGGCTCTTTTCCTGG - Intergenic
1084497883 11:69515618-69515640 CTGGCTGGGCTTGCTCTTCCTGG + Intergenic
1084881515 11:72174781-72174803 GGGGCTGGTGTGGCTTTTCCAGG - Intergenic
1084975751 11:72796948-72796970 GTGGCTGTTGTCTCTTTCCCAGG + Intergenic
1085536578 11:77224065-77224087 CTGGCGTGTCTCGATTTTCCTGG + Intronic
1086509652 11:87543014-87543036 CTGGTGGTTGTGGCTTTTCCAGG + Intergenic
1088650032 11:111949369-111949391 CTGGCTGGTGATGCTTTAACTGG - Intronic
1088675458 11:112188207-112188229 CTGGCTGGTGATGCTTTAACTGG - Intronic
1089649842 11:119905599-119905621 CTGCCTGGTGGAGCTTTCCCAGG + Intergenic
1091913381 12:4250169-4250191 CTCGCTGGTGTGGCATCTCCTGG - Intergenic
1095398421 12:41787546-41787568 CTAGCTGGTGCCTCTTTACCTGG + Intergenic
1097391947 12:59026056-59026078 CTCTTTGGTGTCGATTTTCCTGG - Intergenic
1098737143 12:74119580-74119602 CAAGCTGGTGTGGCATTTCCTGG - Intergenic
1102514158 12:113435325-113435347 CAGGCTGGCGTGGCCTTTCCTGG - Exonic
1102606475 12:114071512-114071534 CTGCCTGGTAGCTCTTTTCCAGG + Intergenic
1103609421 12:122113476-122113498 CAGGCTGGTCTCGCTCTTCTGGG + Intronic
1105412103 13:20179011-20179033 CTTGCTGGTCTTGCTCTTCCTGG + Intergenic
1112330444 13:98473525-98473547 TTGGCTGTTGACCCTTTTCCTGG - Intronic
1122071370 14:99207681-99207703 CTGCCTGGGGGAGCTTTTCCCGG + Intronic
1125608985 15:40958284-40958306 CTGGCTCGTGTCTCCTGTCCGGG - Intergenic
1127469385 15:59276790-59276812 CTGACTGGTGTCTGTTTACCAGG + Intronic
1129744401 15:78008022-78008044 CTGTCTCGTGTCTCTTCTCCAGG - Intronic
1132664800 16:1076441-1076463 CTGGCTGGTGTCTCTCTGGCTGG + Intergenic
1133110773 16:3546834-3546856 TTGCCTGGCGTCTCTTTTCCTGG - Intronic
1134246887 16:12546865-12546887 CAGGCTGGTTTGGTTTTTCCAGG + Intronic
1138435478 16:56997080-56997102 CTGGCTGGTCTCGAACTTCCAGG + Intronic
1139276535 16:65732947-65732969 CTGCCTGGTGTGCCTTTACCGGG + Intergenic
1140217491 16:73020142-73020164 CTTGCTGGTGCCTCTTGTCCTGG - Intronic
1142756368 17:2018701-2018723 CTAGCTGGAGTCCCTTTCCCTGG - Intronic
1143106384 17:4532535-4532557 CTGGCAGGTGTCCCCTGTCCTGG + Exonic
1144574950 17:16423527-16423549 CGGGCTGGTGTGGGTTCTCCAGG - Exonic
1144727962 17:17511272-17511294 CTGGCTGCTGTCCCCCTTCCTGG + Intronic
1146380009 17:32321427-32321449 GTGGCTGCTGTCGTTTTTCTCGG + Exonic
1146442884 17:32912552-32912574 CTGGCTGGTGGCGCTGTCCTTGG + Intergenic
1147810268 17:43163959-43163981 CTGCCTGGTAGCTCTTTTCCAGG - Intergenic
1148828922 17:50416471-50416493 CTGCCTGGTAGCTCTTTTCCAGG - Intergenic
1151058978 17:71068855-71068877 CTGGCTGGTGTTTGTTTTCTTGG - Intergenic
1153293268 18:3522018-3522040 CTAGATGGTGTGACTTTTCCAGG - Intronic
1153826336 18:8878460-8878482 CTGCATGGTGGCTCTTTTCCAGG - Intergenic
1154384865 18:13884142-13884164 CTGCCTGGAGTCGCATGTCCAGG + Exonic
1155058150 18:22203752-22203774 CTGTCTGGGGTCTCTTTTCAGGG + Intergenic
1156767405 18:40674176-40674198 CTTGTTGGTGTCTCTTCTCCAGG - Intergenic
1160043007 18:75362445-75362467 CTCTCTGGTGTTGCTTTTCCGGG - Intergenic
1160740427 19:683034-683056 CTGGCTGGTGTCGCCAGCCCCGG - Exonic
1161111940 19:2475606-2475628 CTGGGTGATTTCGCTTCTCCCGG - Intergenic
1161975009 19:7603635-7603657 CAGGCTGGTTTCGAATTTCCTGG - Intronic
1165040220 19:33063708-33063730 CAGGCTGGGGTCGCTTTTGAGGG + Intronic
1168669430 19:58229485-58229507 CTGCCTGGTGCCGCTGTGCCAGG - Exonic
925484528 2:4313321-4313343 CTGGCTTCAGTCTCTTTTCCAGG + Intergenic
927030286 2:19114351-19114373 CTGGTTGGTGCTGCTTTTTCTGG - Intergenic
927343223 2:22006496-22006518 CTCGCTGGTGACGCCTTTCTGGG + Intergenic
927857534 2:26536824-26536846 CTGGCTGCTGTAGGTTCTCCAGG - Intronic
927866644 2:26592224-26592246 CTGGCTGGGGTCGCTCCTCTGGG - Intronic
939335876 2:140827154-140827176 CTGGCTTGTGTTGGTTTTCTAGG - Intronic
942344478 2:174988061-174988083 CTGGCTGTTGTCACTTTTTATGG - Intronic
942495408 2:176534808-176534830 CTGGCTGCTGTCCTGTTTCCAGG + Intergenic
946027657 2:216681536-216681558 GTGGCTGGTGTAGCAGTTCCTGG + Intronic
1172311809 20:33924228-33924250 CTGGCTGCTGTCGCTTCTCCAGG - Intergenic
1178243534 21:30930015-30930037 CTTGCTGGTGAAGCTTTCCCAGG + Intergenic
1178587599 21:33883173-33883195 CTGGCTGGTGTCGCTTTTCCTGG - Intronic
1180136137 21:45863233-45863255 TTGGCTGGTGACGCTCTTGCAGG - Intronic
1182572215 22:31248010-31248032 CCGTCTGGTGTGGCTCTTCCTGG + Intronic
1183747433 22:39699655-39699677 CAGGCTGGTGGCACTTCTCCTGG + Intergenic
1185022110 22:48382670-48382692 CTGGCTTCTGTCCCTTCTCCTGG - Intergenic
950775127 3:15342698-15342720 CTGGCTGGTGTCCTCTTGCCTGG - Intergenic
951217879 3:20041085-20041107 CTCGCTGGAGTCACTTTCCCGGG + Intronic
952815232 3:37441894-37441916 GCGGCTGGTGTGGCTTTCCCGGG + Intergenic
953824858 3:46242536-46242558 CAGGTAGGTGTCGCTTTTCCAGG + Exonic
956684113 3:71808642-71808664 CTTGCTTGTGTACCTTTTCCAGG + Intergenic
957570318 3:81939099-81939121 ATGGCTACTGTAGCTTTTCCAGG - Intergenic
959881223 3:111447083-111447105 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
961465531 3:127078762-127078784 CTGGCTGGTGTCTCTGGGCCCGG + Intergenic
961571144 3:127799649-127799671 CTGGCTGATGTCTCATCTCCCGG + Intronic
964630184 3:158801932-158801954 CTGGCGCGGTTCGCTTTTCCTGG - Exonic
965014052 3:163132503-163132525 CTTTCGGGTGTTGCTTTTCCAGG - Intergenic
967070682 3:185959974-185959996 TCGGCTGGTGTCGCTGCTCCAGG + Intergenic
968991506 4:3916354-3916376 CTGGCTGGTCTCGAACTTCCAGG - Intergenic
976688484 4:87842638-87842660 CTGGCTGCTTTCTCTTCTCCAGG - Intronic
977543745 4:98350494-98350516 CTGGCTGGTGTCGAACTTCTAGG - Intronic
978186082 4:105858387-105858409 CTGGCTTCTGTCCCCTTTCCAGG + Intronic
983262821 4:165475348-165475370 CTGTCTGGTGGCGCATTGCCAGG - Intronic
984801431 4:183720558-183720580 CTGTCTCGTCTCGCTTTTCGTGG + Intergenic
1202764092 4_GL000008v2_random:136276-136298 CTCCCTGGTCCCGCTTTTCCAGG - Intergenic
986087706 5:4468264-4468286 CTGGCTGGTCTCTCATCTCCTGG - Intergenic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
993576597 5:89609947-89609969 CTGGCAGGTGCCATTTTTCCAGG - Intergenic
994322428 5:98408613-98408635 CTGGCTGGTTTCAGCTTTCCTGG + Intergenic
996105317 5:119495460-119495482 CTGGCTAGTTTAGGTTTTCCTGG - Intronic
1000236867 5:159370102-159370124 CTGCATGGTGGCTCTTTTCCAGG + Intergenic
1001725004 5:173888961-173888983 CTTGCTGCGGTCGCTGTTCCTGG - Exonic
1004340978 6:14807107-14807129 ATGGCAGGTGTTGCTTTTGCCGG + Intergenic
1004900193 6:20186416-20186438 CTGGGTGTTGTCACCTTTCCTGG + Intronic
1006170097 6:32087567-32087589 CTGGTTGGAGTCCCGTTTCCTGG + Intronic
1007136947 6:39531675-39531697 GTGGCTGGTGAGGCTTTTCATGG - Intronic
1008942739 6:57064742-57064764 CTGGCAGATGTGGCTTTTCTGGG + Intergenic
1009961743 6:70531113-70531135 CTCTCTGGTGAAGCTTTTCCAGG + Intronic
1010269332 6:73903258-73903280 CTGGCTGGTGCCACTGGTCCTGG + Intergenic
1014231816 6:118912105-118912127 CAGGCTGGTCTCACATTTCCGGG - Intronic
1014309391 6:119781571-119781593 CTGGGTGCTGTCACGTTTCCTGG + Intergenic
1015540967 6:134313292-134313314 CTGGCTGGTCTCGAGTTTCTGGG - Intronic
1016588126 6:145712709-145712731 CTCTCTGGTGAAGCTTTTCCAGG - Intronic
1018425024 6:163671980-163672002 CTCGCTGGATTCGCTGTTCCGGG + Intergenic
1018768987 6:166956119-166956141 CTGCCTGGCGTTGCTTTGCCTGG - Exonic
1019179639 6:170178233-170178255 CTGGCGGGCGTCGCCTTTGCAGG + Intergenic
1019608704 7:1924062-1924084 CTGGCAGGTTTCTGTTTTCCCGG - Intronic
1022058871 7:26770432-26770454 CTGGCTTCAGTCCCTTTTCCAGG + Intronic
1022955457 7:35376263-35376285 GTGGCTGGGGTGTCTTTTCCAGG - Intergenic
1022972816 7:35532767-35532789 CTGGCAGGTATCGCCCTTCCTGG - Intergenic
1023362439 7:39430620-39430642 CAGGCTGGTGTCAATCTTCCCGG + Intronic
1025106602 7:56175669-56175691 CTGCCTGGCATTGCTTTTCCTGG + Intergenic
1025639016 7:63349980-63350002 CCTGCTGGTGTCGCCTTCCCCGG + Intergenic
1025643683 7:63398112-63398134 CCTGCTGGTGTCGCCTTCCCCGG - Intergenic
1026548778 7:71348689-71348711 CTGGCTGTTGTTGCTTCTGCTGG + Intronic
1032170592 7:129581461-129581483 CTGCATGGTATCTCTTTTCCAGG + Intergenic
1032441283 7:131944850-131944872 CTGGCTGGGTTGTCTTTTCCTGG - Intergenic
1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG + Intronic
1035535819 8:390761-390783 CTGGCTGGTGTCGTTCCTCTGGG + Intergenic
1035710728 8:1712039-1712061 CTGGCTGCAGCCCCTTTTCCAGG - Intergenic
1038020275 8:23546990-23547012 CTGGTTGGTGACGCTTTGCCTGG + Intronic
1040719299 8:50297786-50297808 CTCTCTGGTTTTGCTTTTCCTGG - Intronic
1040900298 8:52411029-52411051 CTGGCTGGTGTCCTGTTTTCCGG - Intronic
1044381683 8:91541433-91541455 GTGGCTGGTGTCTCCTTGCCTGG + Intergenic
1049601944 8:143512059-143512081 CTCGCTGCTGTCACTTCTCCCGG - Intronic
1050750637 9:8932848-8932870 CTGGCTTCCGTCGCCTTTCCAGG + Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057853672 9:98585165-98585187 TTAGCTAGTGTCGCTTTTCTGGG - Intronic
1203544839 Un_KI270743v1:121149-121171 CTCTCTGGTCCCGCTTTTCCAGG - Intergenic
1187501375 X:19841969-19841991 CTGACTGGTGTAACTTTTTCTGG - Intronic
1191690577 X:63934060-63934082 TGGACTGGGGTCGCTTTTCCTGG + Intergenic
1191717787 X:64205231-64205253 CTGGCTGGCGGCGCCCTTCCCGG + Intronic
1193284643 X:79697262-79697284 CTGGCTTCTGTCCCCTTTCCAGG + Intergenic
1198668567 X:139052591-139052613 CTCTCTGGTGAAGCTTTTCCAGG + Intronic
1200908693 Y:8512402-8512424 CTTGATGGTGTGACTTTTCCAGG + Intergenic
1200953811 Y:8925995-8926017 CTGGATGGTTTGACTTTTCCAGG + Intergenic
1202231931 Y:22667372-22667394 CTCGATGGTTTGGCTTTTCCAGG + Intergenic
1202301185 Y:23416188-23416210 CTGGCTGCAGTGGCTCTTCCTGG + Intergenic
1202311225 Y:23528786-23528808 CTCGATGGTTTGGCTTTTCCAGG - Intergenic
1202559577 Y:26141808-26141830 CTCGATGGTTTGGCTTTTCCAGG + Intergenic
1202569626 Y:26254410-26254432 CTGGCTGCAGTGGCTCTTCCTGG - Intergenic