ID: 1178594821

View in Genome Browser
Species Human (GRCh38)
Location 21:33943696-33943718
Sequence AATCAAGTCCTGCTACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178594818_1178594821 11 Left 1178594818 21:33943662-33943684 CCATGATTAGGTAGAGCTGACAA No data
Right 1178594821 21:33943696-33943718 AATCAAGTCCTGCTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178594821 Original CRISPR AATCAAGTCCTGCTACTGCC AGG Intergenic
No off target data available for this crispr