ID: 1178597542

View in Genome Browser
Species Human (GRCh38)
Location 21:33968330-33968352
Sequence CTGTGTCTAAGGAGATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178597539_1178597542 -1 Left 1178597539 21:33968308-33968330 CCTTAATACGTGCTTTCCATTTC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
1178597538_1178597542 5 Left 1178597538 21:33968302-33968324 CCACATCCTTAATACGTGCTTTC 0: 1
1: 0
2: 1
3: 10
4: 96
Right 1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178597542 Original CRISPR CTGTGTCTAAGGAGATACCC TGG Intergenic
900087815 1:906828-906850 CTGTGGCTAAGGAGAATGCCCGG - Intergenic
901988062 1:13091696-13091718 TTTTGTCCAAGGAGGTACCCCGG + Intergenic
901993750 1:13135071-13135093 TTTTGTCCAAGGAGGTACCCCGG - Intergenic
902955476 1:19922055-19922077 CTGTGGGTAGGGAGATACCTGGG + Intronic
904677728 1:32208615-32208637 GTGTGGCTAAGGAGTTACCTGGG + Exonic
905031746 1:34888820-34888842 CTGTGTTTTAGGAAATACGCTGG - Intronic
908683425 1:66687951-66687973 CTGTGTTTTAGGAGAGTCCCTGG - Intronic
909525126 1:76613955-76613977 ATGTGTCTAAGGATATACCAAGG - Intronic
911193549 1:94971790-94971812 CTGTGTCTCATGAGAGACACGGG + Intergenic
919122517 1:193358838-193358860 CTGTTTCTTTGGAGAAACCCTGG - Intergenic
921581903 1:216905147-216905169 CTGTCTGTAAGCAGATACTCCGG + Intronic
923746004 1:236700812-236700834 CTGTGTCTAAATAAATTCCCCGG - Intronic
1063862798 10:10330279-10330301 CTGTGTTTATGAATATACCCAGG - Intergenic
1067746742 10:48941795-48941817 CTGTCCCACAGGAGATACCCCGG + Exonic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG + Intronic
1074581224 10:114721368-114721390 GTATGTCTAAGGAGGTGCCCAGG + Intergenic
1075055447 10:119215050-119215072 CTATGTCAAAGGACATACCCAGG - Intronic
1080884793 11:36356812-36356834 TTGTGTCTCAGGAAATACCAAGG - Intronic
1081526599 11:43931965-43931987 CTGTGTCTGAGGAGAAGCACAGG + Intronic
1089387555 11:118078251-118078273 CTGGGTCTGAGGAGGAACCCAGG + Intronic
1090959305 11:131541901-131541923 CTGTGTATAAAGAGACACACTGG - Intronic
1091046871 11:132332919-132332941 CTGTGACTAAGAAGATGCCCTGG - Intronic
1092282383 12:7108196-7108218 CTGTGGCCAGGGAGATTCCCGGG - Intronic
1093943554 12:25082176-25082198 TTGTGTCTAGGGAGATAAACTGG + Intronic
1100759959 12:97796454-97796476 TAGTGTCTCAGGAGATAACCTGG + Intergenic
1110090941 13:71447310-71447332 CTGTGTCTGAGGAGACAGACAGG + Intronic
1120869466 14:89323999-89324021 CTGTATCTGAGGAGTTGCCCAGG - Intronic
1122250990 14:100439583-100439605 CTGTCTCCAAGGAGAAATCCAGG - Intronic
1131445108 15:92492283-92492305 TTGTGGCTCAGGAGATACTCTGG - Intronic
1132770314 16:1558592-1558614 CTGGGTGTAAGAAGATGCCCAGG - Intronic
1133944027 16:10333729-10333751 ATGTTTTTAAGGAGACACCCTGG + Intronic
1135802656 16:25512488-25512510 ATTTGGCTAAGGAGATTCCCAGG - Intergenic
1139516443 16:67455065-67455087 CAGTGGCTGAGAAGATACCCAGG + Intronic
1146739298 17:35267946-35267968 CTGTGTCCACGGAGAGTCCCTGG - Exonic
1147134523 17:38427571-38427593 CTGGGCCTAAAGAGATGCCCTGG - Intergenic
1149683448 17:58521211-58521233 CTGAGGGCAAGGAGATACCCTGG + Intronic
1151980042 17:77503248-77503270 CTGTCCCCAAGGAGAGACCCAGG + Intergenic
1153572510 18:6487343-6487365 CTGTTGCTAAGGAGATACTCAGG - Intergenic
1154300305 18:13186113-13186135 CTGTGTCTCAGGGGACAGCCTGG + Intergenic
1156581819 18:38386098-38386120 CTGTCTCAGAGGAGATGCCCTGG - Intergenic
1159548393 18:69869755-69869777 CTGGGACTAAGGAGTTTCCCAGG + Intronic
1162553173 19:11369727-11369749 CTGTGTGTCAGGAGAGACCACGG - Intergenic
1167379495 19:49130326-49130348 CTGTGTCTCCGGAGACACTCTGG + Intronic
1167512866 19:49905539-49905561 TTGTGTCTAAGTAGAAACCATGG - Intronic
1168488426 19:56785782-56785804 CTGTGTTTAACAAGATCCCCAGG - Intronic
925036516 2:691183-691205 CTGTGCCGAAGCAGATACCCAGG + Intergenic
925311124 2:2882573-2882595 CGTTGTCAAAGCAGATACCCGGG + Intergenic
925381890 2:3434013-3434035 CTGTCTCTGAAGAGCTACCCTGG - Intronic
925475501 2:4209744-4209766 CTGTGTGTAACCAGAAACCCAGG + Intergenic
926104784 2:10143301-10143323 CTGGGTCTGAGGAGGTTCCCAGG - Intronic
927544386 2:23940219-23940241 CTGAGGCTGAGGAGGTACCCAGG + Intronic
928294167 2:30068511-30068533 CTGTCTCTAAGGTGAGACCTTGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930376844 2:50578534-50578556 CTGTGTTTATGTAAATACCCTGG - Intronic
931324134 2:61200813-61200835 CTGTTTCCAAGGAGAGGCCCAGG - Intronic
932380962 2:71282319-71282341 CTGAGTCTAAGGAGCTTCCCTGG - Intronic
934882886 2:97998462-97998484 ATGTGTCTCAGGAGAGAACCAGG + Intergenic
935120890 2:100182723-100182745 ATGTGGCTAAGGGGATCCCCAGG + Intergenic
937082274 2:119148628-119148650 CTGTGTGTTAGGAGACACCAAGG - Intergenic
939039580 2:137172156-137172178 CTGTATCTCAGGAAATAACCAGG - Intronic
941297989 2:163764353-163764375 CTGAGACTAAGCAGATATCCAGG - Intergenic
941575906 2:167229936-167229958 CCATGCCTAAGTAGATACCCAGG - Intronic
941731868 2:168926812-168926834 CTGCATATAATGAGATACCCTGG + Intronic
941838521 2:170053348-170053370 GAGTCTCTAATGAGATACCCTGG + Intronic
946582897 2:221149977-221149999 CTGTGTCAAAGTAAATACTCTGG - Intergenic
948031507 2:234821437-234821459 CTGGGACTAAGGAGATGGCCAGG + Intergenic
949062152 2:241967436-241967458 CAGTGACTATGGAGAAACCCAGG - Intergenic
1168975473 20:1962494-1962516 CTTTGTCTGTGGTGATACCCTGG - Intergenic
1170595363 20:17801514-17801536 CTGGGATTAAGGAGATATCCAGG + Intergenic
1172486663 20:35302451-35302473 CTGTGGCTGGGGAGCTACCCTGG + Intergenic
1175978109 20:62723708-62723730 CTGTGTCTGAGGAGGTCCCTGGG - Intronic
1178000243 21:28154004-28154026 CTGTGTCCAAGGAGCTCCCTGGG - Intergenic
1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG + Intergenic
1179126952 21:38599210-38599232 CTGGGTACAAGGATATACCCAGG - Intronic
1179591000 21:42407745-42407767 GTGCGTCTAAGCAGATTCCCTGG + Intronic
1180143195 21:45905469-45905491 CTGTGCCGAAGGAGAGAGCCAGG + Intronic
1180149999 21:45942553-45942575 CTGTGTGTGAGAAGAAACCCAGG - Intergenic
1182475968 22:30576531-30576553 CTCTGTCTCAGTAAATACCCAGG + Intergenic
950521148 3:13498780-13498802 CCTTGTCTAAGGAGGTCCCCGGG + Intronic
957748817 3:84384106-84384128 TTGTTTCTAATGGGATACCCTGG + Intergenic
962713184 3:138104288-138104310 CTGTGTCTAAGGAGGAACATGGG + Intronic
963580697 3:147123158-147123180 CTGTGCTTAAGTAGATACCAAGG + Intergenic
976161255 4:82201698-82201720 CTGTGTCTAAGCTGGTTCCCAGG - Intergenic
990606642 5:57417143-57417165 CTGTGTCTCAGGAATGACCCAGG - Intergenic
992322899 5:75631522-75631544 CTGTGCCTAAGGAGTTATTCAGG + Intronic
993837722 5:92835451-92835473 CTGTGGATCAGGAGATCCCCTGG - Intergenic
993886699 5:93423228-93423250 CTGTAGCTAAGGAGAGGCCCCGG - Intergenic
999248020 5:150165787-150165809 CTGTGTGTTAGGTAATACCCAGG + Intergenic
1000794738 5:165650926-165650948 CTTTGTATAAAGAGATTCCCTGG + Intergenic
1006792289 6:36711162-36711184 CTGTGTTTAAGGTGACACACTGG + Intronic
1007842774 6:44730334-44730356 CTGTATCTCAGAACATACCCTGG + Intergenic
1008097386 6:47352788-47352810 CTGAGTCTAAGCTGGTACCCAGG + Intergenic
1010253455 6:73732156-73732178 CTGAGACTAAGGAGGTTCCCAGG - Intronic
1018039829 6:159911888-159911910 CCCTGGCTAAGGTGATACCCTGG + Exonic
1020941390 7:14542868-14542890 CTGTGTTTACGGAGATCCCAGGG + Intronic
1027197941 7:76044110-76044132 CTCTCTCTAAGGAAATACCAAGG - Intronic
1027364960 7:77447769-77447791 CTGTCCCTAAGAAGATGCCCTGG - Intergenic
1027640615 7:80729223-80729245 CAGTCTCTTAGGAGATGCCCAGG - Intergenic
1031733132 7:125322583-125322605 ATGTGTCTAGGGAGAGACCTGGG - Intergenic
1036664056 8:10727408-10727430 CTGTGGCTAAGCAGGTGCCCTGG - Intronic
1037558052 8:20045142-20045164 CTTTCTCTAAGGACTTACCCTGG - Intergenic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1039041467 8:33412508-33412530 CTGTGTCTGAGTAGATCCACTGG + Intronic
1042043879 8:64625420-64625442 CTGTGACTAAGGAGATCTCCGGG + Intronic
1043665298 8:82803244-82803266 CTGTTTCTAAGAAGAAACACAGG - Intergenic
1045403016 8:101837533-101837555 CTGTGTCTAAGTAGAGAACATGG - Intronic
1045419158 8:101996999-101997021 CTGACTCTAAGTAGATACCAAGG - Intronic
1047327819 8:123856993-123857015 CTGTGTCAATGAGGATACCCAGG - Intronic
1047664988 8:127081788-127081810 GTGGGTCTAAGGAGAGGCCCAGG - Intergenic
1048192843 8:132305994-132306016 GTGTGTCTAAGAAGATGCCCAGG - Intronic
1050077565 9:1880997-1881019 CTGTGTGTTAGAAGATAGCCCGG + Intergenic
1050346692 9:4695791-4695813 CTGTCTCAAAGGAGATAAGCTGG - Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1061790567 9:133056944-133056966 CTGTCTCAAAGGAGATCACCAGG - Intronic
1062069165 9:134546203-134546225 CTGTGGCTAAGGAAACACCAAGG - Intergenic
1190850516 X:54235981-54236003 TTGTGTCTAAGGAGAGAACCTGG + Intronic
1192100478 X:68259043-68259065 CTATTTCTAAGTATATACCCAGG + Intronic
1193971266 X:88056886-88056908 CTGTGTCTCAGGAAATAGGCAGG - Intergenic
1195888588 X:109668186-109668208 GTGTGTCTGAGGAGATAGCGGGG + Exonic
1198706978 X:139460371-139460393 CTGTGTCTGAGTAGATTCTCTGG + Intergenic
1199860467 X:151796670-151796692 CAGTGGCTAAGAAAATACCCAGG + Intergenic
1200670425 Y:6081414-6081436 CTGTGTCAAAGTTGATACTCTGG + Intergenic
1201719826 Y:17084367-17084389 CTGTGTCACAGGAGAAACACAGG - Intergenic