ID: 1178605620

View in Genome Browser
Species Human (GRCh38)
Location 21:34034206-34034228
Sequence CCCACGTATCAAGAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178605620_1178605624 -7 Left 1178605620 21:34034206-34034228 CCATGCACCTCTTGATACGTGGG No data
Right 1178605624 21:34034222-34034244 ACGTGGGGTTATTTGCTGTCTGG No data
1178605620_1178605625 18 Left 1178605620 21:34034206-34034228 CCATGCACCTCTTGATACGTGGG No data
Right 1178605625 21:34034247-34034269 CTATTCTGAATAAAGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178605620 Original CRISPR CCCACGTATCAAGAGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr