ID: 1178605620 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:34034206-34034228 |
| Sequence | CCCACGTATCAAGAGGTGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1178605620_1178605625 | 18 | Left | 1178605620 | 21:34034206-34034228 | CCATGCACCTCTTGATACGTGGG | No data | ||
| Right | 1178605625 | 21:34034247-34034269 | CTATTCTGAATAAAGCTGCTAGG | No data | ||||
| 1178605620_1178605624 | -7 | Left | 1178605620 | 21:34034206-34034228 | CCATGCACCTCTTGATACGTGGG | No data | ||
| Right | 1178605624 | 21:34034222-34034244 | ACGTGGGGTTATTTGCTGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1178605620 | Original CRISPR | CCCACGTATCAAGAGGTGCA TGG (reversed) | Intergenic | ||