ID: 1178605625

View in Genome Browser
Species Human (GRCh38)
Location 21:34034247-34034269
Sequence CTATTCTGAATAAAGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178605620_1178605625 18 Left 1178605620 21:34034206-34034228 CCATGCACCTCTTGATACGTGGG No data
Right 1178605625 21:34034247-34034269 CTATTCTGAATAAAGCTGCTAGG No data
1178605623_1178605625 11 Left 1178605623 21:34034213-34034235 CCTCTTGATACGTGGGGTTATTT No data
Right 1178605625 21:34034247-34034269 CTATTCTGAATAAAGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178605625 Original CRISPR CTATTCTGAATAAAGCTGCT AGG Intergenic
No off target data available for this crispr