ID: 1178608209

View in Genome Browser
Species Human (GRCh38)
Location 21:34057551-34057573
Sequence CCTACCCCAGGGAGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178608209_1178608219 -5 Left 1178608209 21:34057551-34057573 CCAGACCCCCTCCCTGGGGTAGG No data
Right 1178608219 21:34057569-34057591 GTAGGGCAGCCAAGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178608209 Original CRISPR CCTACCCCAGGGAGGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr