ID: 1178616182

View in Genome Browser
Species Human (GRCh38)
Location 21:34135171-34135193
Sequence TACCTATAACAACCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178616182_1178616183 15 Left 1178616182 21:34135171-34135193 CCAGTTTGGGGTTGTTATAGGTA 0: 1
1: 0
2: 2
3: 36
4: 248
Right 1178616183 21:34135209-34135231 TTTGTGTACAAGTTGTTGTGTGG 0: 2
1: 65
2: 259
3: 759
4: 1459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178616182 Original CRISPR TACCTATAACAACCCCAAAC TGG (reversed) Intronic
900890756 1:5448103-5448125 TATTTATAACAGCCCCAACCTGG + Intergenic
901268472 1:7931343-7931365 TACATGTAATAACCCCAAGCTGG + Intronic
901623811 1:10611424-10611446 TACTCATAATAGCCCCAAACTGG - Intronic
904636046 1:31882428-31882450 TATCTGTAAAAACCCCAATCTGG + Intergenic
905958521 1:42022110-42022132 TTCCTCTGCCAACCCCAAACTGG + Intronic
906051653 1:42879745-42879767 TATTTGTAATAACCCCAAACTGG - Intergenic
906090189 1:43172334-43172356 TTCCTATAGCAACGACAAACCGG - Exonic
906504140 1:46365268-46365290 TACTAATAATAGCCCCAAACTGG - Intergenic
906577482 1:46903946-46903968 TACCTACAACCAACCCAAATGGG + Intergenic
906800041 1:48729180-48729202 TACTCAGAACAACCCCATACAGG - Intronic
909653905 1:78008309-78008331 TATTTATAATAGCCCCAAACTGG + Intronic
911391518 1:97250454-97250476 TACCCATAACAGCTCAAAACTGG + Intronic
913002801 1:114598189-114598211 TATTCATAACAACCTCAAACTGG + Intronic
913338824 1:117735765-117735787 AATCTTTAATAACCCCAAACTGG - Intergenic
915767725 1:158382646-158382668 TATTTATAAGAGCCCCAAACTGG + Intergenic
917999239 1:180475773-180475795 TATTTATAATAACCCCAAACTGG - Intronic
918240392 1:182615416-182615438 GTTCTATAACAATCCCAAACTGG - Intergenic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
919987134 1:202683267-202683289 TAGTCATAACAACCCCAGACTGG + Intronic
921776794 1:219110968-219110990 TACCCATAATAACTCAAAACTGG + Intergenic
1063791240 10:9450421-9450443 TATTCATAACATCCCCAAACTGG - Intergenic
1064878818 10:20026407-20026429 TACCAATAAGAAGTCCAAACTGG + Intronic
1065161181 10:22924164-22924186 TATTTATAACAGTCCCAAACTGG + Intergenic
1066514852 10:36146813-36146835 TTTCTGTACCAACCCCAAACAGG + Intergenic
1067423838 10:46185774-46185796 TATTTTTAATAACCCCAAACTGG + Intergenic
1067938141 10:50628531-50628553 TATTTATAACAGCCCCAAACTGG + Intergenic
1070860242 10:79651016-79651038 TATTTTTAATAACCCCAAACTGG + Intergenic
1070877028 10:79824520-79824542 TATTTTTAATAACCCCAAACTGG - Intergenic
1071348917 10:84719766-84719788 TATTTGTAATAACCCCAAACTGG + Intergenic
1071533850 10:86411250-86411272 TCCCTATAACAAACATAAACAGG + Intergenic
1073672232 10:105605003-105605025 TAATTTTAACAGCCCCAAACTGG + Intergenic
1073773253 10:106758604-106758626 CACATATAACACCCCCAAAAAGG + Intronic
1076211687 10:128651985-128652007 TATTTATAAGAGCCCCAAACTGG + Intergenic
1077145816 11:1043739-1043761 TGTTTGTAACAACCCCAAACTGG + Intergenic
1077924333 11:6665702-6665724 TACTTATAATAGCCCCAAAGTGG - Intergenic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1081951887 11:47051579-47051601 TATATAAAACCACCCCAAACTGG + Intronic
1083669004 11:64290232-64290254 TCCCTATCACCACCCCAACCTGG + Intergenic
1083956336 11:65985376-65985398 TATTTATAACAGCCCCAAACTGG + Intergenic
1086023698 11:82263651-82263673 TATTTATAATAACCTCAAACTGG - Intergenic
1086031576 11:82364810-82364832 TAGTTTTAATAACCCCAAACTGG + Intergenic
1087543926 11:99559771-99559793 TAGTAATAATAACCCCAAACTGG + Intronic
1088135240 11:106548907-106548929 TATTTATAACAGCCCAAAACTGG + Intergenic
1088308499 11:108435490-108435512 AAATTATAACAACCCCAAACAGG + Intronic
1091472461 12:741078-741100 TGCCTATAACAAGCCAAGACAGG - Intergenic
1093249044 12:16777562-16777584 TATTTATAACAATGCCAAACTGG + Intergenic
1093395659 12:18678766-18678788 TTTTTATAATAACCCCAAACTGG - Intergenic
1093721660 12:22449889-22449911 TGCCTATAAGAACAACAAACAGG + Exonic
1093954955 12:25205756-25205778 TACCTATCATTATCCCAAACAGG + Intronic
1095828234 12:46553336-46553358 TACCGGAAACAAACCCAAACTGG - Intergenic
1097413805 12:59289160-59289182 TACCTATAACAAACCTGCACAGG - Intergenic
1100782406 12:98043102-98043124 TCCCAATTGCAACCCCAAACGGG - Intergenic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1101813086 12:108124394-108124416 TATTTATAATACCCCCAAACTGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103570502 12:121841488-121841510 TACGTATAACACCCCAAAAGTGG + Intronic
1103674504 12:122644912-122644934 TGCCTATAAAAACCCGAGACCGG - Intergenic
1103995970 12:124830402-124830424 TACCCATAACAGCCCAAAACTGG + Intronic
1104343190 12:127971159-127971181 TCTTTATAACCACCCCAAACTGG + Intergenic
1106326508 13:28695632-28695654 CATCTATAATAGCCCCAAACTGG - Intergenic
1106775991 13:33010409-33010431 CACCTCTAACAAGCCCAAAAGGG - Intergenic
1107681156 13:42852391-42852413 TATCTATAATAGCTCCAAACTGG + Intergenic
1108665608 13:52627070-52627092 TACTCATAATAGCCCCAAACTGG - Intergenic
1108897263 13:55347878-55347900 TACCTATGACAAGTCTAAACGGG - Intergenic
1112545248 13:100361965-100361987 TGTTTATAACAGCCCCAAACTGG + Intronic
1113268281 13:108643723-108643745 TACTCATAATAGCCCCAAACTGG - Intronic
1114161901 14:20177820-20177842 TACCCCTAACAGCCCCAAACTGG + Intergenic
1115620949 14:35139652-35139674 TATTTATAACAGCACCAAACTGG - Intronic
1116575000 14:46562951-46562973 TACTTTTAAGAACCCCAAACTGG + Intergenic
1117235078 14:53765191-53765213 TACCTAAAACATCTCCAAAATGG + Intergenic
1118163395 14:63313047-63313069 TACCTACAACGAGACCAAACAGG - Exonic
1118282920 14:64445459-64445481 TTCCTGTAACCACCCCAAACTGG - Intronic
1118293125 14:64543940-64543962 TATCTATAACAATCTCAAATTGG - Exonic
1118424217 14:65641435-65641457 TATTTATAACAGCCCCAAAGTGG - Intronic
1118800995 14:69189765-69189787 TACTTTCAACAGCCCCAAACGGG - Intergenic
1121402860 14:93696234-93696256 TATCTGTAAAAGCCCCAAACTGG - Intronic
1121855194 14:97262616-97262638 TACATGTAATAACCCCAAACTGG + Intergenic
1121958098 14:98232753-98232775 TATTCATAATAACCCCAAACTGG + Intergenic
1122276918 14:100595593-100595615 TGTTTATAACAACCCAAAACTGG - Intergenic
1122833417 14:104416762-104416784 TATTTATAACAACCCAAAACTGG + Intergenic
1123972798 15:25524708-25524730 TATCCATAATTACCCCAAACTGG + Intergenic
1124230123 15:27937328-27937350 TATTTATAATAGCCCCAAACTGG - Intronic
1124457043 15:29852969-29852991 TAATTATAATATCCCCAAACTGG + Intronic
1124706074 15:31965781-31965803 TATTCATAATAACCCCAAACTGG + Intergenic
1124711113 15:32012762-32012784 TACTTTTAATAGCCCCAAACTGG - Intergenic
1125178517 15:36853956-36853978 TATTTATAACAGCTCCAAACAGG + Intergenic
1126239320 15:46423782-46423804 TAACAATTACAGCCCCAAACTGG + Intergenic
1127829213 15:62735799-62735821 CATTTATAACAGCCCCAAACAGG + Intronic
1130179931 15:81615414-81615436 TATCTATAAGAACCCCAAACTGG - Intergenic
1130203359 15:81853630-81853652 TACCTAAAACAACCCCAAAAGGG + Intergenic
1130249438 15:82288049-82288071 TATCTATAGTCACCCCAAACAGG + Intergenic
1130392141 15:83466302-83466324 TATTCATAATAACCCCAAACTGG - Intronic
1130450618 15:84048036-84048058 TATCTATAATCACCCCAAACTGG - Intergenic
1130852846 15:87814595-87814617 TATTCATAATAACCCCAAACTGG + Intergenic
1131340293 15:91593007-91593029 TATTCATAACAGCCCCAAACTGG - Intergenic
1131896291 15:97034352-97034374 TATTTATAATAGCCCCAAACTGG + Intergenic
1131905549 15:97138109-97138131 TATTAATAATAACCCCAAACTGG + Intergenic
1132420072 15:101658206-101658228 TATTTATAATAGCCCCAAACAGG + Intronic
1133986054 16:10669134-10669156 TATTTGTAACAGCCCCAAACTGG + Intronic
1134901858 16:17945349-17945371 TACTCATAATAGCCCCAAACTGG + Intergenic
1135110268 16:19685461-19685483 TACTCATAATAGCCCCAAACTGG - Intronic
1135629984 16:24028744-24028766 TACTTATAATAGCCCCAAACTGG - Intronic
1135711503 16:24721331-24721353 TACTCATAATAGCCCCAAACTGG + Intergenic
1137386294 16:48045593-48045615 TCACTATATCAAGCCCAAACTGG + Intergenic
1137751744 16:50867178-50867200 TAGTTATAATAGCCCCAAACTGG - Intergenic
1137872240 16:51961574-51961596 TATTTATAATAGCCCCAAACTGG + Intergenic
1139790901 16:69434290-69434312 TATTCATAACAGCCCCAAACTGG - Intronic
1140463012 16:75156580-75156602 TGCCAATAACCTCCCCAAACGGG - Intronic
1141384794 16:83610738-83610760 TACCTAAATTATCCCCAAACTGG - Intronic
1142800459 17:2341906-2341928 TATCCATAACAGCCCCAAACTGG + Intronic
1143743176 17:8968942-8968964 TATTTATAATAGCCCCAAACTGG + Intergenic
1143905410 17:10205095-10205117 TATTTATAACAGCCCCAAACTGG + Intergenic
1145300743 17:21634464-21634486 TACCTATAATAATCAAAAACTGG - Intergenic
1145349557 17:22068792-22068814 TACCTATAATAATCAAAAACTGG + Intergenic
1148403528 17:47388679-47388701 TATTCATAACAGCCCCAAACTGG - Intronic
1150074094 17:62177954-62177976 TGTTTATAACCACCCCAAACTGG + Intergenic
1151052724 17:70996694-70996716 TATTTATTACACCCCCAAACTGG - Intergenic
1152057613 17:78042930-78042952 TACATACAAAACCCCCAAACCGG - Intronic
1152138345 17:78520824-78520846 TTCCTATAAAAACCCCAATAAGG + Intronic
1152945661 17:83196146-83196168 TACAAAGAACAACCACAAACTGG - Intergenic
1154929695 18:20980185-20980207 TATTTATAACAGCTCCAAACTGG + Intronic
1155283088 18:24260970-24260992 TATTTATAATATCCCCAAACTGG + Intronic
1155830627 18:30511980-30512002 TACCTTTAAAAAACCCAAAGAGG + Intergenic
1159227078 18:65553697-65553719 TACTCATAATAACCCCAAACTGG + Intergenic
1159381858 18:67670436-67670458 TATTTATAATAACCCCAAACTGG + Intergenic
1162704649 19:12546423-12546445 TACCTATAAGAAAGCCAGACAGG + Intronic
1162704804 19:12547545-12547567 TAACTATTACAACCTCAGACAGG + Intronic
1164619364 19:29685119-29685141 TATTCATAACAACCCCAAACTGG - Intergenic
1167914516 19:52729580-52729602 TACCTATAACCACACAGAACAGG + Intronic
1168446254 19:56417117-56417139 TATTTATAATAGCCCCAAACTGG - Intronic
925402937 2:3588603-3588625 TACCTATAATATCCCAAAACAGG - Intergenic
929128912 2:38546650-38546672 TATCTGTAATAGCCCCAAACTGG - Intergenic
929903564 2:46026820-46026842 TTTCTATAAAACCCCCAAACAGG + Intronic
930356443 2:50327107-50327129 TAGGTATAATAGCCCCAAACTGG + Intronic
930450362 2:51528243-51528265 TATTCATAACAGCCCCAAACTGG - Intergenic
931150304 2:59565585-59565607 CACCTATAAAAAAGCCAAACGGG + Intergenic
931504286 2:62907063-62907085 TATCCATAAGAGCCCCAAACAGG - Intronic
932602467 2:73137576-73137598 TATTCATAATAACCCCAAACAGG - Intronic
932605365 2:73162138-73162160 TATTTATAACAGCCCCCAACTGG + Intergenic
932783866 2:74582354-74582376 TAATAATAAAAACCCCAAACGGG + Intronic
934082254 2:88478956-88478978 AACCTGTAATAGCCCCAAACTGG - Intergenic
934869478 2:97849278-97849300 TATTTATAATAACTCCAAACTGG + Intronic
935305158 2:101730383-101730405 TCCCTACCACAACCCCAAAAAGG - Intronic
937851027 2:126636514-126636536 TACTTATAATTGCCCCAAACTGG + Intergenic
939178866 2:138781175-138781197 TGTCTATACCATCCCCAAACCGG - Intergenic
942186275 2:173427690-173427712 GATCTATTACAACCCCAAAGTGG + Intergenic
943596222 2:189860503-189860525 TACTCATAATAGCCCCAAACTGG - Intronic
946783338 2:223216130-223216152 TATTTATAATAGCCCCAAACTGG + Intergenic
946964517 2:225023511-225023533 TACCAATAATACCACCAAACTGG + Intronic
947192175 2:227518223-227518245 TACTGATAATAACCCCAAACTGG - Intronic
947548195 2:231027199-231027221 CCTCTATAAAAACCCCAAACGGG + Intergenic
948018060 2:234706326-234706348 CCCCTATAGCAGCCCCAAACCGG + Intergenic
1168999697 20:2159445-2159467 TATTTATAATAGCCCCAAACTGG + Intronic
1169710342 20:8554322-8554344 TATTCATAAAAACCCCAAACTGG + Intronic
1169834069 20:9858334-9858356 TATCAATAATAATCCCAAACTGG - Intergenic
1170296942 20:14837767-14837789 TACCTATATCATGCCCAACCAGG + Intronic
1171559694 20:26112219-26112241 TACCTATAATAATCAAAAACTGG + Intergenic
1171964968 20:31523025-31523047 TCCCAAAAAAAACCCCAAACAGG - Intronic
1173087253 20:39935109-39935131 TATTTATAATAGCCCCAAACTGG + Intergenic
1173302152 20:41813642-41813664 TATTTACAACAGCCCCAAACTGG + Intergenic
1174041288 20:47701642-47701664 TATTTGTAATAACCCCAAACTGG + Intronic
1174075543 20:47933157-47933179 TATCCATAACAGCCCCACACTGG + Intergenic
1174957984 20:55122602-55122624 TATCTCTAATAACCCAAAACTGG + Intergenic
1175117925 20:56696245-56696267 TATTTATGACAGCCCCAAACTGG - Intergenic
1175207194 20:57320235-57320257 TATTTATAATAACCCAAAACTGG + Intergenic
1175584711 20:60129324-60129346 TGTCTATAATAACCCCAAACTGG + Intergenic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1177606932 21:23391988-23392010 TATTTATAACAGCACCAAACTGG + Intergenic
1178616182 21:34135171-34135193 TACCTATAACAACCCCAAACTGG - Intronic
1179715822 21:43287631-43287653 TATTTATAACAGCCCCAAACCGG - Intergenic
1182175880 22:28288460-28288482 TTTTTATAACAGCCCCAAACTGG + Intronic
1182274863 22:29181523-29181545 TATTTATAATAGCCCCAAACTGG + Intergenic
1182385957 22:29941330-29941352 TACTCATAACAGCCCCAAACTGG - Intronic
950503506 3:13378729-13378751 TACCTATTTCTACACCAAACAGG + Intronic
951063885 3:18241837-18241859 TATTTATAATGACCCCAAACTGG + Intronic
951479634 3:23146041-23146063 TATTTGTAACAGCCCCAAACTGG - Intergenic
952373026 3:32741345-32741367 TATTTGTAACAGCCCCAAACTGG - Intronic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
953448275 3:42986048-42986070 TACGTATAATTGCCCCAAACTGG + Intronic
953703861 3:45216706-45216728 TACATATTTTAACCCCAAACTGG - Intergenic
955370547 3:58347647-58347669 TATTTATAATAGCCCCAAACTGG - Intronic
955618411 3:60834055-60834077 TATCTGTAATAGCCCCAAACTGG - Intronic
956800071 3:72749303-72749325 TATTTATAACAGCCCCAAACTGG + Exonic
956852550 3:73243769-73243791 TATTCATAACAGCCCCAAACAGG + Intergenic
956857264 3:73287342-73287364 CACCTTTAAGAACCCCCAACTGG - Intergenic
957322249 3:78646983-78647005 TACTTAGAAGAACTCCAAACTGG + Intronic
959975075 3:112449796-112449818 TATTTATAACAGCCCCAAACTGG + Intergenic
960336337 3:116421994-116422016 TCCTCATAACAGCCCCAAACTGG + Intronic
961392702 3:126564456-126564478 TACTTATAACAGCCTCAACCTGG - Intergenic
961669150 3:128516177-128516199 TATTCATAATAACCCCAAACAGG + Intergenic
963828670 3:149983443-149983465 TATTTGTAATAACCCCAAACTGG + Intronic
964407960 3:156369364-156369386 TATTTATAATAACCCCAAACTGG - Intronic
965978280 3:174653231-174653253 TATATATAGCAGCCCCAAACTGG + Intronic
966314496 3:178630579-178630601 TACTTATAAAAACCAGAAACTGG - Intronic
966956086 3:184880590-184880612 TATTTTTAACAGCCCCAAACTGG - Intronic
967008509 3:185408605-185408627 CATCTACAACAACCCCAAAAGGG + Intronic
967628917 3:191719817-191719839 TATTTATAATAGCCCCAAACTGG - Intergenic
968601199 4:1510331-1510353 TATCTGTAACAGCCCCAAACTGG - Intergenic
973565219 4:52179428-52179450 TATGTATAATAGCCCCAAACTGG + Intergenic
975777089 4:77799110-77799132 TATTTATAACAGCCCAAAACTGG + Intronic
977615059 4:99079220-99079242 TAACTGTAACCACCCAAAACTGG + Intronic
979082704 4:116362517-116362539 TACCTATATTAACCTCAAATTGG - Intergenic
979217071 4:118178669-118178691 TACCTAAAACAACTGAAAACAGG - Intronic
979821682 4:125181769-125181791 TACTCATAATAACCCAAAACTGG + Intergenic
980272970 4:130611065-130611087 TATTTATAATAGCCCCAAACTGG + Intergenic
981280779 4:142955608-142955630 TATTTATAATGACCCCAAACTGG + Intergenic
982255830 4:153450942-153450964 TATCTGTAATAACTCCAAACTGG - Intergenic
982487643 4:155986677-155986699 TACTCATAATAGCCCCAAACTGG - Intergenic
983530006 4:168800828-168800850 TGCTCATAATAACCCCAAACTGG + Intronic
985870598 5:2551929-2551951 TATCCATAACAGCCCCAAACTGG - Intergenic
986398065 5:7350226-7350248 TATTTATAATAGCCCCAAACTGG - Intergenic
987793846 5:22603734-22603756 TACCTATAACTCCCCCAATCTGG - Intronic
989458492 5:41669189-41669211 TACATAGAACAACCCTATACAGG + Intergenic
991480202 5:67069728-67069750 TAGATATAACTACCACAAACTGG - Intronic
992308380 5:75467035-75467057 TATTTGTAACAGCCCCAAACTGG + Intronic
993419208 5:87679549-87679571 TATTTGTAATAACCCCAAACTGG + Intergenic
994323286 5:98418353-98418375 TATCTGTAATAACCCCAAATTGG + Intergenic
995199073 5:109406757-109406779 TATTAATAACAGCCCCAAACTGG + Intronic
995508989 5:112889316-112889338 TACCTACAACAAAACCAAATAGG + Intronic
996564044 5:124861231-124861253 TATTCATAACAGCCCCAAACTGG + Intergenic
996804925 5:127443859-127443881 TATCTGTAATAGCCCCAAACTGG - Intronic
997515700 5:134487968-134487990 TATTTATAACAGCCCCAAACTGG - Intergenic
997692576 5:135836735-135836757 TTATTATAACAACCCCAAAGAGG + Intronic
998449648 5:142224326-142224348 TATTTATAATAGCCCCAAACTGG + Intergenic
1001905707 5:175471238-175471260 TATTCATAACAGCCCCAAACTGG + Intergenic
1003252656 6:4444587-4444609 TACTTGTAACAGCCCCAAACTGG - Intergenic
1003476113 6:6485015-6485037 TATTCATAACAGCCCCAAACTGG + Intergenic
1004875478 6:19947384-19947406 TATTCATAACAGCCCCAAACTGG - Intergenic
1005138929 6:22604198-22604220 CCTCTATAAAAACCCCAAACTGG - Intergenic
1005797746 6:29385589-29385611 TATTCATAACAACCCAAAACTGG + Intronic
1006974548 6:38086957-38086979 TAACCAGAACAACCTCAAACTGG + Intronic
1008161357 6:48079901-48079923 TTCCTATAATAATCCCAAATTGG - Intergenic
1008754252 6:54775203-54775225 TACCTATCATTATCCCAAACAGG - Intergenic
1010689782 6:78896294-78896316 TATTTATAATAGCCCCAAACTGG + Intronic
1011541122 6:88431104-88431126 TATTTATAATAGCCCCAAACTGG + Intergenic
1013416309 6:109927914-109927936 TAACTCTAACAACACCCAACAGG + Intergenic
1017033319 6:150243739-150243761 TATTTATAATAGCCCCAAACTGG + Intronic
1019989006 7:4679542-4679564 TACCTATTTCAGCCCCAGACTGG + Intergenic
1020492464 7:8804877-8804899 TACTCACAATAACCCCAAACTGG + Intergenic
1025278031 7:57601549-57601571 TACCTATAATAATCAAAAACTGG - Intergenic
1026674917 7:72420357-72420379 TTCCTCTTGCAACCCCAAACAGG + Intronic
1028620299 7:92819132-92819154 TATTTATAACAGCCCTAAACTGG + Intronic
1028959689 7:96734783-96734805 TACCTACCACTACCCCAATCAGG - Intergenic
1031192150 7:118566787-118566809 TATTTATAATAGCCCCAAACTGG + Intergenic
1034570654 7:151953436-151953458 TATTTATAACACCCCCAAAGTGG + Intergenic
1035226834 7:157438369-157438391 TTCCTACAACAACCCCATCCGGG - Intergenic
1036447794 8:8837998-8838020 TATTTATAATCACCCCAAACTGG + Intronic
1036508053 8:9374156-9374178 TACTTATAATCACCCCAAACTGG + Intergenic
1036742686 8:11379234-11379256 TATTCATAACAGCCCCAAACTGG - Intergenic
1037402137 8:18503949-18503971 TACTTACAAAAAACCCAAACTGG + Intergenic
1037429567 8:18795336-18795358 TACCTCTAAGAACCACAACCAGG + Intronic
1038398456 8:27264763-27264785 TATTCATAATAACCCCAAACTGG + Intergenic
1040588707 8:48769187-48769209 TATTTGTAATAACCCCAAACTGG + Intergenic
1041141431 8:54823725-54823747 TATTTATAACAGCCCCAAACTGG - Intergenic
1041524517 8:58790268-58790290 TTGCAATAGCAACCCCAAACAGG - Intergenic
1041657529 8:60368903-60368925 TACTTATAACAACCAAAAAGTGG + Intergenic
1042204674 8:66317177-66317199 TACTCATAATAGCCCCAAACTGG + Intergenic
1046242271 8:111511820-111511842 TACTTATAATAGACCCAAACTGG + Intergenic
1046943932 8:119957183-119957205 TACTAAAAACAACCCCAAGCTGG - Intronic
1049295493 8:141832319-141832341 TATCCATAACAGCCCCAAACTGG - Intergenic
1050588324 9:7136254-7136276 TATTTATAATAGCCCCAAACAGG - Intergenic
1050862812 9:10457553-10457575 TATCTATAACAGCCCCAAAATGG - Intronic
1050985206 9:12073404-12073426 GAACTCTAACAACCTCAAACAGG + Intergenic
1052103234 9:24477240-24477262 TATACATAATAACCCCAAACTGG + Intergenic
1052558610 9:30053123-30053145 AACCTATAACAGCCCAAACCCGG + Intergenic
1054194223 9:62014511-62014533 TATTTATAATAACCTCAAACTGG + Intergenic
1054644184 9:67574179-67574201 TATTTATAATAACCTCAAACTGG - Intergenic
1056914629 9:90735322-90735344 TATGTATAATAGCCCCAAACTGG + Intergenic
1057536232 9:95909724-95909746 TATCTATAATAATCCAAAACTGG - Intronic
1058588346 9:106533975-106533997 TATTTATAAGAGCCCCAAACTGG - Intergenic
1059342530 9:113606256-113606278 TATATGTAACAGCCCCAAACTGG - Intergenic
1059546888 9:115185068-115185090 TATCCATAATAACCCAAAACTGG - Intronic
1059832650 9:118115650-118115672 TGTTTATAAAAACCCCAAACTGG + Intergenic
1186350505 X:8734183-8734205 TAACTATAATGACCCCAAGCAGG + Intergenic
1186416877 X:9391513-9391535 TATCTACAATAGCCCCAAACGGG + Intergenic
1187968545 X:24636977-24636999 TATTCATAATAACCCCAAACTGG - Intronic
1188177081 X:27004100-27004122 TACTTATAATAGTCCCAAACTGG + Intergenic
1189519889 X:41755354-41755376 AAAGTTTAACAACCCCAAACAGG + Intronic
1189669998 X:43398233-43398255 AACATATAACAATCCCAAATAGG + Intergenic
1190783234 X:53619252-53619274 TACCAATAGGAACCCCAAAAAGG - Intronic
1190866640 X:54390394-54390416 TATTCATAACAGCCCCAAACTGG - Intergenic
1193276431 X:79593690-79593712 AACCTATAATTACCCCAAAAAGG + Intergenic
1195549825 X:106155540-106155562 TATTTGTAACAGCCCCAAACTGG + Intergenic
1196011773 X:110896842-110896864 TATTTATAAAAGCCCCAAACTGG + Intergenic
1196840395 X:119853940-119853962 TATTTATAATAACTCCAAACTGG + Intergenic
1197219704 X:123899805-123899827 TATTTATAATAGCCCCAAACTGG - Intronic
1197246243 X:124170027-124170049 TATTTATAACAGCCCCAAACTGG + Intronic