ID: 1178617324

View in Genome Browser
Species Human (GRCh38)
Location 21:34145438-34145460
Sequence CTTTCCTCCAGCCAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178617324_1178617331 7 Left 1178617324 21:34145438-34145460 CCTGCCCCCTGGCTGGAGGAAAG No data
Right 1178617331 21:34145468-34145490 GCTCCAGTCTACGAGAGTGGAGG No data
1178617324_1178617330 4 Left 1178617324 21:34145438-34145460 CCTGCCCCCTGGCTGGAGGAAAG No data
Right 1178617330 21:34145465-34145487 CTGGCTCCAGTCTACGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178617324 Original CRISPR CTTTCCTCCAGCCAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr