ID: 1178617778

View in Genome Browser
Species Human (GRCh38)
Location 21:34148371-34148393
Sequence TAAAGAACTTGGTAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178617772_1178617778 27 Left 1178617772 21:34148321-34148343 CCTGGACCGAGTTACTGCCTGGT No data
Right 1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG No data
1178617773_1178617778 21 Left 1178617773 21:34148327-34148349 CCGAGTTACTGCCTGGTTTGCTG No data
Right 1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG No data
1178617774_1178617778 10 Left 1178617774 21:34148338-34148360 CCTGGTTTGCTGAAGAGTTATTC No data
Right 1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG No data
1178617770_1178617778 28 Left 1178617770 21:34148320-34148342 CCCTGGACCGAGTTACTGCCTGG No data
Right 1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178617778 Original CRISPR TAAAGAACTTGGTAGTTGGT AGG Intergenic
No off target data available for this crispr