ID: 1178624084

View in Genome Browser
Species Human (GRCh38)
Location 21:34201253-34201275
Sequence GAGTGAATGAACGCTGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178624084_1178624085 -5 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624085 21:34201271-34201293 CACTCATCAAACATCTTGTGAGG No data
1178624084_1178624086 -4 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624086 21:34201272-34201294 ACTCATCAAACATCTTGTGAGGG No data
1178624084_1178624088 2 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624088 21:34201278-34201300 CAAACATCTTGTGAGGGCCAGGG No data
1178624084_1178624087 1 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624087 21:34201277-34201299 TCAAACATCTTGTGAGGGCCAGG No data
1178624084_1178624089 14 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624089 21:34201290-34201312 GAGGGCCAGGGCTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178624084 Original CRISPR GAGTGAATGAACGCTGTTCC CGG (reversed) Intergenic
No off target data available for this crispr