ID: 1178624086

View in Genome Browser
Species Human (GRCh38)
Location 21:34201272-34201294
Sequence ACTCATCAAACATCTTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178624083_1178624086 4 Left 1178624083 21:34201245-34201267 CCTGACTGCCGGGAACAGCGTTC No data
Right 1178624086 21:34201272-34201294 ACTCATCAAACATCTTGTGAGGG No data
1178624079_1178624086 19 Left 1178624079 21:34201230-34201252 CCTTCATTCAAGGGCCCTGACTG No data
Right 1178624086 21:34201272-34201294 ACTCATCAAACATCTTGTGAGGG No data
1178624082_1178624086 5 Left 1178624082 21:34201244-34201266 CCCTGACTGCCGGGAACAGCGTT No data
Right 1178624086 21:34201272-34201294 ACTCATCAAACATCTTGTGAGGG No data
1178624084_1178624086 -4 Left 1178624084 21:34201253-34201275 CCGGGAACAGCGTTCATTCACTC No data
Right 1178624086 21:34201272-34201294 ACTCATCAAACATCTTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178624086 Original CRISPR ACTCATCAAACATCTTGTGA GGG Intergenic
No off target data available for this crispr